ID: 1008508722

View in Genome Browser
Species Human (GRCh38)
Location 6:52256231-52256253
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008508716_1008508722 -7 Left 1008508716 6:52256215-52256237 CCATCTGCTCTCCAGCCCCACAT No data
Right 1008508722 6:52256231-52256253 CCCACATTCACCCTTGGACTGGG No data
1008508715_1008508722 -1 Left 1008508715 6:52256209-52256231 CCAAAACCATCTGCTCTCCAGCC No data
Right 1008508722 6:52256231-52256253 CCCACATTCACCCTTGGACTGGG No data
1008508713_1008508722 1 Left 1008508713 6:52256207-52256229 CCCCAAAACCATCTGCTCTCCAG No data
Right 1008508722 6:52256231-52256253 CCCACATTCACCCTTGGACTGGG No data
1008508711_1008508722 29 Left 1008508711 6:52256179-52256201 CCTGATGATCTGAGGTGGAACGG 0: 22
1: 772
2: 1118
3: 828
4: 463
Right 1008508722 6:52256231-52256253 CCCACATTCACCCTTGGACTGGG No data
1008508714_1008508722 0 Left 1008508714 6:52256208-52256230 CCCAAAACCATCTGCTCTCCAGC No data
Right 1008508722 6:52256231-52256253 CCCACATTCACCCTTGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008508722 Original CRISPR CCCACATTCACCCTTGGACT GGG Intergenic
No off target data available for this crispr