ID: 1008508726

View in Genome Browser
Species Human (GRCh38)
Location 6:52256262-52256284
Sequence ACTTCCATGAAACCAGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008508725_1008508726 -3 Left 1008508725 6:52256242-52256264 CCTTGGACTGGGAAAAACTGACT No data
Right 1008508726 6:52256262-52256284 ACTTCCATGAAACCAGTCCCTGG No data
1008508721_1008508726 8 Left 1008508721 6:52256231-52256253 CCCACATTCACCCTTGGACTGGG No data
Right 1008508726 6:52256262-52256284 ACTTCCATGAAACCAGTCCCTGG No data
1008508724_1008508726 -2 Left 1008508724 6:52256241-52256263 CCCTTGGACTGGGAAAAACTGAC No data
Right 1008508726 6:52256262-52256284 ACTTCCATGAAACCAGTCCCTGG No data
1008508718_1008508726 13 Left 1008508718 6:52256226-52256248 CCAGCCCCACATTCACCCTTGGA No data
Right 1008508726 6:52256262-52256284 ACTTCCATGAAACCAGTCCCTGG No data
1008508716_1008508726 24 Left 1008508716 6:52256215-52256237 CCATCTGCTCTCCAGCCCCACAT No data
Right 1008508726 6:52256262-52256284 ACTTCCATGAAACCAGTCCCTGG No data
1008508723_1008508726 7 Left 1008508723 6:52256232-52256254 CCACATTCACCCTTGGACTGGGA No data
Right 1008508726 6:52256262-52256284 ACTTCCATGAAACCAGTCCCTGG No data
1008508719_1008508726 9 Left 1008508719 6:52256230-52256252 CCCCACATTCACCCTTGGACTGG No data
Right 1008508726 6:52256262-52256284 ACTTCCATGAAACCAGTCCCTGG No data
1008508715_1008508726 30 Left 1008508715 6:52256209-52256231 CCAAAACCATCTGCTCTCCAGCC No data
Right 1008508726 6:52256262-52256284 ACTTCCATGAAACCAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008508726 Original CRISPR ACTTCCATGAAACCAGTCCC TGG Intergenic
No off target data available for this crispr