ID: 1008509488

View in Genome Browser
Species Human (GRCh38)
Location 6:52262961-52262983
Sequence CTTTGGTTCGTTAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008509488_1008509495 23 Left 1008509488 6:52262961-52262983 CCCTTTGTCCTAACGAACCAAAG No data
Right 1008509495 6:52263007-52263029 GGATCACCCCTCAGCAAAAATGG No data
1008509488_1008509492 -4 Left 1008509488 6:52262961-52262983 CCCTTTGTCCTAACGAACCAAAG No data
Right 1008509492 6:52262980-52263002 AAAGAATATCTCCTGCTTTGTGG No data
1008509488_1008509493 2 Left 1008509488 6:52262961-52262983 CCCTTTGTCCTAACGAACCAAAG No data
Right 1008509493 6:52262986-52263008 TATCTCCTGCTTTGTGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008509488 Original CRISPR CTTTGGTTCGTTAGGACAAA GGG (reversed) Intergenic
No off target data available for this crispr