ID: 1008511035

View in Genome Browser
Species Human (GRCh38)
Location 6:52276082-52276104
Sequence GGATTCTGCTGTGCAGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008511035 Original CRISPR GGATTCTGCTGTGCAGGAAT GGG Intronic
901125088 1:6923606-6923628 GGCTTCTGGTATGCAGGAAGAGG + Intronic
901782689 1:11604396-11604418 GTAAACTGCTGTGCAGGGATAGG + Intergenic
902706753 1:18210718-18210740 GGCATCTGGTGTGCAGGAACCGG - Intronic
903381561 1:22900569-22900591 CCATTCTGCTGAGCTGGAATGGG + Intronic
905474140 1:38213960-38213982 GGCTTCTGCTCTGCAGGCCTTGG + Intergenic
908736830 1:67285286-67285308 TGATTCAGCTGTTCTGGAATAGG + Intergenic
910063689 1:83125202-83125224 GAATTCTGATGTGCAAGCATGGG + Intergenic
912457957 1:109811442-109811464 GGAATCTGCTGTGCTGCAAGAGG - Intergenic
913385416 1:118253482-118253504 GCTGTCTCCTGTGCAGGAATAGG + Intergenic
915770056 1:158411687-158411709 GTGTTCTCCTGTGCAGAAATTGG - Intergenic
915970717 1:160353263-160353285 GGATTCTGAGCTGTAGGAATAGG - Intronic
1063362313 10:5468638-5468660 GTAGTCTGTTGTGCAGCAATGGG + Intergenic
1064320903 10:14303603-14303625 GAATTCAGCTGTGCAGGACTCGG + Intronic
1065758889 10:28963265-28963287 GCATGCTGCTTTACAGGAATGGG - Intergenic
1066094614 10:32060182-32060204 AGAATCTGTTGTGCAGGAAGAGG - Intergenic
1069533067 10:69233147-69233169 GGAAGCAGCAGTGCAGGAATTGG + Intronic
1073483154 10:103799592-103799614 AGATTCTGCAATGCAGGAGTGGG + Intronic
1073563291 10:104515361-104515383 GGATTCTGCAGAGCAGCATTTGG - Intergenic
1074498370 10:113999881-113999903 TGATTCTGCTGTGGAAGAAAAGG - Intergenic
1076189139 10:128470496-128470518 GGACTCTGCTGTGCCGGGAGTGG - Intergenic
1080648477 11:34204292-34204314 GGTCACTGCTGTGCAGGAATGGG + Intronic
1081734192 11:45391926-45391948 GAATTCTGCAGAGCAGTAATTGG - Intergenic
1083006398 11:59350883-59350905 AGATTATGCAGTCCAGGAATTGG - Intergenic
1083826765 11:65208295-65208317 GGATTCTGATGTGGAAGAAATGG - Intronic
1086217724 11:84403863-84403885 GGATTCCAGTATGCAGGAATAGG - Intronic
1088154474 11:106786519-106786541 GGACATTCCTGTGCAGGAATTGG - Intronic
1089095690 11:115918282-115918304 GGACTCTCCTCTGCTGGAATTGG - Intergenic
1096151343 12:49315055-49315077 GGAGTCTGTTGTCCAAGAATAGG + Intergenic
1096476950 12:51914188-51914210 GAATTCTGCTGGGCAGGGAGTGG + Intronic
1100167796 12:91937988-91938010 GGAAGCTGCTGTACAGGAAGTGG - Intergenic
1102043772 12:109817159-109817181 GGGCTTTGCTCTGCAGGAATGGG + Intronic
1102080511 12:110094237-110094259 GGATGCTGCTCTTCAGGAAAAGG + Intergenic
1102951412 12:117033900-117033922 GAACTCTGCTGTGCTGGAAACGG - Intergenic
1103197723 12:119059644-119059666 GGATTCTGCTGTGCAACATAAGG + Intronic
1103304889 12:119956200-119956222 GTAACCTGCTGTGCAGGATTGGG - Intergenic
1103462226 12:121114054-121114076 GGATGCTGCTCTTCAGGAAAAGG - Intergenic
1104383479 12:128328421-128328443 GGATGCTGCTGTCTAGGGATGGG + Intronic
1105405798 13:20131568-20131590 GGATTATGTTGTCCAGTAATGGG - Intergenic
1106111283 13:26779677-26779699 GAATGCTCCTGTGCAGGAAAGGG + Intergenic
1106137318 13:26983397-26983419 GCATTCTGCTTTCCGGGAATTGG - Intergenic
1107339990 13:39395615-39395637 GGTTTCTGCTGTGGAGTCATTGG + Intronic
1108451128 13:50564348-50564370 TGAGTCTGCAGTGGAGGAATTGG - Intronic
1108997956 13:56759303-56759325 GGATACATCTGTGGAGGAATGGG - Intergenic
1111602062 13:90487297-90487319 GTAATTTGCTATGCAGGAATAGG + Intergenic
1117201588 14:53395262-53395284 GGATTCTGTTGTTCAGCAACTGG + Intergenic
1117265216 14:54079485-54079507 GGATGATGCTGTACAGGGATGGG - Intergenic
1124555299 15:30719556-30719578 GGCTGCTGCTGTGCAGGAGAAGG - Intronic
1126758806 15:51950314-51950336 GGTTTCTGCTGGGCATGAATGGG - Intronic
1127124118 15:55795549-55795571 GGATTCCACTGTGCAGTATTTGG - Intergenic
1127186909 15:56489890-56489912 GTATTCTGTTGAGCAGGAAGCGG - Intergenic
1128080378 15:64853701-64853723 GGAGTGTGCTGTGCTGGAAAGGG + Intronic
1129864049 15:78889168-78889190 GGCTTCTACTGTTCAAGAATGGG - Intronic
1130569298 15:85026210-85026232 GGATTCTGTGGCTCAGGAATTGG + Intronic
1131142824 15:89991565-89991587 GGATTCTTCAGAGCAGGAAACGG + Intergenic
1133077209 16:3289132-3289154 CGATTCTGCCCTTCAGGAATGGG - Intronic
1133689733 16:8201734-8201756 GGCTTCGGCTGTGCAGGACAGGG - Intergenic
1134237747 16:12480836-12480858 GGTCTCTGCTGTGCAGGAGCTGG + Intronic
1135981746 16:27153189-27153211 GGGTTCTGCTGTACAGGCCTCGG + Intergenic
1137361325 16:47818679-47818701 GAATTCTGCTGGGCAAGACTGGG + Intergenic
1137950650 16:52780553-52780575 GGATTTTACTGTGGAGGGATAGG - Intergenic
1141461455 16:84180734-84180756 AGTTTCTGCTGTGCAGGAGGCGG - Intronic
1142477544 17:198368-198390 GGATCCTGCTGTGGAGGCCTGGG - Intergenic
1144777443 17:17791881-17791903 GGATTCTGCTCTGCAGGCAGGGG + Intronic
1149032813 17:52103347-52103369 GGATTGTGCTGTGGACGACTGGG - Intronic
1151678871 17:75613762-75613784 GGATCCTGCAGAGCAGGTATGGG + Intergenic
1152028119 17:77824842-77824864 GTATTCTGCAGTGCTGGAGTTGG - Intergenic
1153081294 18:1228685-1228707 GGCTTTTACTGTGCAGAAATTGG - Intergenic
1153614726 18:6923865-6923887 GGACCCTGCTGTGCAGCAATGGG - Intergenic
1156013166 18:32517252-32517274 GGATTCTGTTTTGCTGTAATTGG + Intergenic
1158478169 18:57798705-57798727 GGCTTCTACTGTGCAGGAAGAGG + Intronic
1160045298 18:75381003-75381025 GGGTTGTGCTGTCCAGGGATGGG - Intergenic
1161176505 19:2845830-2845852 GAGTTATGCTGTGCAGGAATTGG - Intronic
1161563270 19:4985545-4985567 GGATCCTGCTGTGCAGGCTGGGG + Intronic
1162050502 19:8029593-8029615 GGATTGTGCTATGCGGGAAGAGG - Intronic
1163313767 19:16529433-16529455 ATCTTCTGCTGTTCAGGAATGGG + Intronic
1163762800 19:19146380-19146402 ATATTCTGGTGGGCAGGAATTGG + Exonic
1164793491 19:31007482-31007504 GGATTCTACTGTGAAAGACTTGG + Intergenic
1166820000 19:45573191-45573213 GGACTATGCTGTGGGGGAATTGG - Intronic
1167321562 19:48799916-48799938 GGATTCTGCAGGGCAGGGGTGGG - Intronic
1168126061 19:54283749-54283771 GGAGTCTGCAGTGAAGGGATGGG + Intergenic
1168313873 19:55475391-55475413 GGATCTTGCTGGGCAGGGATGGG + Intergenic
925958652 2:8994474-8994496 GGCTTCTGCTGTACAGAAACAGG + Intronic
926209788 2:10861450-10861472 GGGTTCTGTTGGGAAGGAATAGG - Intergenic
927792029 2:26017880-26017902 GAATCCTGCTCTGCAGGAATAGG + Intergenic
927822341 2:26278862-26278884 GGACTCTGCTATGCTGTAATAGG + Intronic
929011820 2:37452392-37452414 AGATTCTACTTTGCAGGAATTGG + Intergenic
929523172 2:42674018-42674040 GGATTCTGCTGAGCTAGACTGGG + Intronic
929528173 2:42725770-42725792 GGATTCTGCAGTGCTGGAGCAGG - Intronic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
931650794 2:64467025-64467047 GAATTCTGCTGTCAAGGAACTGG - Intergenic
936902284 2:117495229-117495251 TGATTCTGCTGAGCAGAACTGGG - Intergenic
937048199 2:118864261-118864283 GGTTTCTGCTGGGCAGAAATTGG - Intergenic
939627859 2:144500667-144500689 GGTTTCTACTGTGGTGGAATTGG - Intronic
940723041 2:157302623-157302645 AGATTCTGCGTTGCTGGAATGGG - Intronic
944313338 2:198259329-198259351 GGATTCTGCCTTCCAGGAAAGGG + Intronic
945735904 2:213600026-213600048 ATTTTCTGCTGTGTAGGAATTGG + Intronic
946657567 2:221964807-221964829 GGATTATACTGTGTAGGCATTGG + Intergenic
946750859 2:222895288-222895310 GGACACAGATGTGCAGGAATAGG - Intronic
948359923 2:237412866-237412888 GGAGTCTGCTGTGCTGGATGGGG - Intronic
948535839 2:238646136-238646158 GGGTTTTGCTGTGCAGCAATGGG - Intergenic
1173747390 20:45448353-45448375 GGGTTCTGCTGTGAAGGAGAAGG - Intergenic
1177363173 21:20100374-20100396 GGATTCTGGAGAGAAGGAATAGG - Intergenic
1177821639 21:26036509-26036531 GTATTCTGCTGGGCAGGTAAAGG + Intronic
1180248641 21:46564873-46564895 GGGTTTGGCTGTGCAGGAAGTGG - Intronic
1180671455 22:17557045-17557067 GGACTCTGCCGTGCAGCCATAGG + Intronic
1181646196 22:24232854-24232876 GGATGCTGTTGTGCAGGAAACGG + Exonic
1182770417 22:32791653-32791675 GTATGCTGCCGTGCTGGAATTGG - Intronic
1184815077 22:46862829-46862851 TGATTCTGGGGTGCAGGACTGGG + Intronic
1185221064 22:49629530-49629552 GGATTCTAGGGTGCAGGATTGGG + Intronic
949295184 3:2513386-2513408 GGATTTTTCTGTTCAGAAATAGG + Intronic
950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG + Intergenic
950793127 3:15489283-15489305 AGATTCTTCTTAGCAGGAATTGG - Intronic
954220388 3:49150054-49150076 GGGTGCTGCTGGGCAGGAATTGG + Intergenic
955331389 3:58050347-58050369 GTAATTTGCTGTGCAGGAGTGGG + Intronic
955759989 3:62269567-62269589 AGATTCTGCTGTTCAAGAATGGG + Intronic
956431800 3:69193852-69193874 GGATCCTGCTTTGCAAGAACTGG - Exonic
956725015 3:72149825-72149847 GATTTTTGCTGTGCAGGACTGGG + Intergenic
959839167 3:110954332-110954354 GGATTCTGTGTTGCAGGAAAAGG - Intergenic
960083050 3:113561660-113561682 GGATTCTGATGTACATGGATGGG - Intronic
964425996 3:156554755-156554777 GGATTGTCCTGTGCAGCACTCGG - Intronic
967826459 3:193881573-193881595 GGATGCTGCTGTCCAGGCAATGG - Intergenic
967887171 3:194341277-194341299 GGATCTGGCTGTGCAGGAAAGGG - Exonic
970099562 4:12504823-12504845 GAATTCAGTTTTGCAGGAATGGG + Intergenic
973198908 4:47477658-47477680 TGTTACTGCTCTGCAGGAATGGG - Intergenic
975651662 4:76599369-76599391 GGATTTTGCTGTGCTTGAATGGG - Intronic
981001073 4:139829525-139829547 GGATTCCACTGTGCAGTGATGGG + Intronic
982838956 4:160158167-160158189 TGATTCTCCTGTCCATGAATAGG - Intergenic
984604844 4:181773347-181773369 GGATTCTGCAATGTAGAAATGGG - Intergenic
993770720 5:91922155-91922177 TGATTCTCCTGTGCAGGCAGGGG + Intergenic
994757618 5:103814606-103814628 TAATTCTGCTTTGAAGGAATGGG - Intergenic
999298413 5:150475040-150475062 GGATTCTGCTGTGCAGACACTGG + Intergenic
1002311903 5:178320013-178320035 GCATTCAGCCATGCAGGAATGGG - Intronic
1003601953 6:7525922-7525944 GGATTCGGCTGTGGAGGGAGTGG + Intergenic
1005782488 6:29207194-29207216 GGATTCTGTTTTGTAGGACTTGG + Intergenic
1006972576 6:38062013-38062035 GGATTCTAATGTGCAGACATAGG - Intronic
1007703619 6:43778344-43778366 GGGTTCTGCAGAGCAGGGATGGG - Intronic
1008511035 6:52276082-52276104 GGATTCTGCTGTGCAGGAATGGG + Intronic
1008533726 6:52490155-52490177 GGATCCAGGCGTGCAGGAATTGG + Exonic
1017562854 6:155648814-155648836 GCATTTTGCTGTGCAGAATTAGG + Intergenic
1018301994 6:162413094-162413116 GGCTTCTTCTGTGCAGTAATAGG + Intronic
1018521016 6:164652317-164652339 GTTTTCTGGTGTGCAGGAGTGGG + Intergenic
1020908103 7:14091302-14091324 TGATGCTGCTGTCAAGGAATGGG - Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1026325679 7:69307183-69307205 GGAAGATGCTGTGCAGGAAGGGG - Intergenic
1027741549 7:82013741-82013763 GTATTCTTCTATGAAGGAATAGG + Intronic
1034030162 7:147752910-147752932 GAATTCTGCTCTACAGAAATTGG - Intronic
1034572208 7:151965075-151965097 GGGTTTTGCTGTGCAGGGCTGGG + Intronic
1034877652 7:154739441-154739463 GGACACTGCTGTGGGGGAATGGG + Intronic
1040889912 8:52306339-52306361 GGATTCTGCATTGCAGCAAGAGG - Intronic
1040936735 8:52789375-52789397 GGACACTGCAGTGCAGGGATGGG - Intergenic
1047135801 8:122076833-122076855 GAATTCTGCTTTGCAGGAGAAGG - Intergenic
1048153069 8:131912932-131912954 GGATTATGTTGTTCAGGAATAGG + Intronic
1048328635 8:133457301-133457323 GGGTTTTGCTGTGTAAGAATAGG - Exonic
1048969823 8:139639238-139639260 GGATTCTGGTGAGCATCAATGGG - Intronic
1051734927 9:20188337-20188359 GGAGTCTGCTGTGAACAAATGGG + Intergenic
1053475902 9:38381931-38381953 GGATTCTGCTGTTAAAGGATGGG - Intergenic
1053819663 9:41953379-41953401 GGAGTCTGCTGAGCAGAAACGGG + Exonic
1054109930 9:61097032-61097054 GGAGTCTGCTGAGCAGAAACGGG + Intergenic
1054610927 9:67234093-67234115 GGAGTCTGCTGAGCAGAAACGGG - Intergenic
1055378256 9:75675013-75675035 GGATTCCGCTGTGAAGCCATCGG + Intergenic
1055669642 9:78590008-78590030 GGGTTCTGGTGTTCAGTAATTGG - Intergenic
1056500020 9:87199595-87199617 GGGGTCTGCTTTACAGGAATTGG + Intergenic
1056873795 9:90308484-90308506 GAACTCTGCTGGGCAGGGATTGG - Intergenic
1057517483 9:95734360-95734382 GCTGTCTGCAGTGCAGGAATTGG + Intergenic
1057934670 9:99226782-99226804 GGACTCTGCTGCCAAGGAATAGG - Intronic
1062299560 9:135857713-135857735 GGATTCTTCTCTGCAGAAATCGG - Intronic
1185654971 X:1677334-1677356 GGATTCTCCTGGGCAGGCCTGGG - Intergenic
1189554765 X:42130538-42130560 AGATTCTGCTGTTGAGGAGTTGG - Intergenic
1190123952 X:47686935-47686957 GGATTCTGCTGGTCAGTGATTGG + Intergenic
1192138693 X:68630140-68630162 GGAATCTGGAGGGCAGGAATGGG - Intergenic
1192147090 X:68689153-68689175 GGAATCTGGAGGGCAGGAATGGG + Intronic
1194336801 X:92658189-92658211 GTGTTCTGCTGGGCAGGAAGTGG - Intergenic
1196326265 X:114407412-114407434 GAATGCTGCTGTGAAGGAAATGG - Intergenic
1196365251 X:114916378-114916400 GGAGTCTGATGTTCAAGAATAGG + Intergenic
1197076052 X:122354016-122354038 GAATTCTGCTGTGAAGCCATTGG - Intergenic
1197155886 X:123269790-123269812 GCATTCTTCTCTGCAGCAATGGG - Intronic
1198053178 X:132968601-132968623 GGAATCTCCTGGGCAGGGATTGG + Intergenic
1199329085 X:146537501-146537523 GGATTCTACTGTCCAAGAATGGG + Intergenic
1200645234 Y:5774929-5774951 GTGTTCTGCTGGGCAGGAAGTGG - Intergenic