ID: 1008513425

View in Genome Browser
Species Human (GRCh38)
Location 6:52298084-52298106
Sequence CTGTGTGAGCAAAGGCAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008513425_1008513433 18 Left 1008513425 6:52298084-52298106 CCCAATTGCCTTTGCTCACACAG No data
Right 1008513433 6:52298125-52298147 CCCTATAAATGACAGTTGGATGG No data
1008513425_1008513431 14 Left 1008513425 6:52298084-52298106 CCCAATTGCCTTTGCTCACACAG No data
Right 1008513431 6:52298121-52298143 ATATCCCTATAAATGACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008513425 Original CRISPR CTGTGTGAGCAAAGGCAATT GGG (reversed) Intergenic
No off target data available for this crispr