ID: 1008514600

View in Genome Browser
Species Human (GRCh38)
Location 6:52307281-52307303
Sequence CTGTCTGTCCATCGGTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008514600_1008514606 25 Left 1008514600 6:52307281-52307303 CCCACGGACCGATGGACAGACAG No data
Right 1008514606 6:52307329-52307351 GTAGCCACCGCGCTGGCCCCGGG No data
1008514600_1008514604 18 Left 1008514600 6:52307281-52307303 CCCACGGACCGATGGACAGACAG No data
Right 1008514604 6:52307322-52307344 TCGCACAGTAGCCACCGCGCTGG No data
1008514600_1008514605 24 Left 1008514600 6:52307281-52307303 CCCACGGACCGATGGACAGACAG No data
Right 1008514605 6:52307328-52307350 AGTAGCCACCGCGCTGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008514600 Original CRISPR CTGTCTGTCCATCGGTCCGT GGG (reversed) Intergenic
No off target data available for this crispr