ID: 1008514680

View in Genome Browser
Species Human (GRCh38)
Location 6:52307638-52307660
Sequence AGAGATCCTTCAGGTGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008514680_1008514685 0 Left 1008514680 6:52307638-52307660 CCCGGGACACCTGAAGGATCTCT No data
Right 1008514685 6:52307661-52307683 CTGCGTCATCTGTTGTTGAGGGG No data
1008514680_1008514684 -1 Left 1008514680 6:52307638-52307660 CCCGGGACACCTGAAGGATCTCT No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data
1008514680_1008514683 -2 Left 1008514680 6:52307638-52307660 CCCGGGACACCTGAAGGATCTCT No data
Right 1008514683 6:52307659-52307681 CTCTGCGTCATCTGTTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008514680 Original CRISPR AGAGATCCTTCAGGTGTCCC GGG (reversed) Intergenic
No off target data available for this crispr