ID: 1008514684

View in Genome Browser
Species Human (GRCh38)
Location 6:52307660-52307682
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008514674_1008514684 12 Left 1008514674 6:52307625-52307647 CCCTCCCTCACTCCCCGGGACAC No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data
1008514679_1008514684 0 Left 1008514679 6:52307637-52307659 CCCCGGGACACCTGAAGGATCTC No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data
1008514675_1008514684 11 Left 1008514675 6:52307626-52307648 CCTCCCTCACTCCCCGGGACACC No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data
1008514681_1008514684 -2 Left 1008514681 6:52307639-52307661 CCGGGACACCTGAAGGATCTCTC No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data
1008514682_1008514684 -10 Left 1008514682 6:52307647-52307669 CCTGAAGGATCTCTCTGCGTCAT No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data
1008514676_1008514684 8 Left 1008514676 6:52307629-52307651 CCCTCACTCCCCGGGACACCTGA No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data
1008514671_1008514684 25 Left 1008514671 6:52307612-52307634 CCTCAGGGATGGTCCCTCCCTCA No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data
1008514677_1008514684 7 Left 1008514677 6:52307630-52307652 CCTCACTCCCCGGGACACCTGAA No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data
1008514680_1008514684 -1 Left 1008514680 6:52307638-52307660 CCCGGGACACCTGAAGGATCTCT No data
Right 1008514684 6:52307660-52307682 TCTGCGTCATCTGTTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008514684 Original CRISPR TCTGCGTCATCTGTTGTTGA GGG Intergenic
No off target data available for this crispr