ID: 1008520317

View in Genome Browser
Species Human (GRCh38)
Location 6:52356790-52356812
Sequence ATTTTATCCTGGGGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008520317_1008520324 1 Left 1008520317 6:52356790-52356812 CCCTCTCTCCCCCAGGATAAAAT No data
Right 1008520324 6:52356814-52356836 ACTGAGAATCAGGAGCAAAGTGG No data
1008520317_1008520323 -9 Left 1008520317 6:52356790-52356812 CCCTCTCTCCCCCAGGATAAAAT No data
Right 1008520323 6:52356804-52356826 GGATAAAATGACTGAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008520317 Original CRISPR ATTTTATCCTGGGGGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr