ID: 1008522535

View in Genome Browser
Species Human (GRCh38)
Location 6:52375830-52375852
Sequence CTTTAAACACTGATGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008522533_1008522535 -10 Left 1008522533 6:52375817-52375839 CCTGGCTGGGATGCTTTAAACAC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1008522535 6:52375830-52375852 CTTTAAACACTGATGGTTCATGG 0: 1
1: 0
2: 2
3: 23
4: 150
1008522531_1008522535 -2 Left 1008522531 6:52375809-52375831 CCACCATGCCTGGCTGGGATGCT 0: 1
1: 0
2: 56
3: 349
4: 2013
Right 1008522535 6:52375830-52375852 CTTTAAACACTGATGGTTCATGG 0: 1
1: 0
2: 2
3: 23
4: 150
1008522527_1008522535 25 Left 1008522527 6:52375782-52375804 CCAAAGCACTAGGATTACAGGTA 0: 13
1: 333
2: 3800
3: 33498
4: 218676
Right 1008522535 6:52375830-52375852 CTTTAAACACTGATGGTTCATGG 0: 1
1: 0
2: 2
3: 23
4: 150
1008522532_1008522535 -5 Left 1008522532 6:52375812-52375834 CCATGCCTGGCTGGGATGCTTTA 0: 1
1: 0
2: 3
3: 68
4: 506
Right 1008522535 6:52375830-52375852 CTTTAAACACTGATGGTTCATGG 0: 1
1: 0
2: 2
3: 23
4: 150
1008522525_1008522535 29 Left 1008522525 6:52375778-52375800 CCTTCCAAAGCACTAGGATTACA 0: 31
1: 458
2: 5558
3: 52078
4: 353726
Right 1008522535 6:52375830-52375852 CTTTAAACACTGATGGTTCATGG 0: 1
1: 0
2: 2
3: 23
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008522535 Original CRISPR CTTTAAACACTGATGGTTCA TGG Intronic
908997650 1:70176673-70176695 GTTTAAACACTTGTTGTTCAAGG - Intronic
909592607 1:77368022-77368044 CTTTTAACAATGATGGGTGAAGG + Intronic
909595442 1:77401177-77401199 CTTTAAAAACTCATGGCTCCTGG - Intronic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
914442350 1:147718585-147718607 CCTTAAACAGTGATGGCTCAGGG - Intergenic
915729558 1:158043516-158043538 CTGGGAACACTGATAGTTCAGGG + Intronic
916806739 1:168267344-168267366 CTTTAAACAGTGATGGCTCAGGG + Intergenic
917603431 1:176601043-176601065 CTCTCAACACTGTTGCTTCAGGG - Intronic
917886211 1:179387767-179387789 CTGTAAAAACTCATGATTCATGG - Intronic
918038557 1:180898116-180898138 CTTTAAAAACATAGGGTTCAGGG - Intergenic
918519057 1:185394849-185394871 CTGTAAACACAGATAGTTCTGGG - Intergenic
919508542 1:198430692-198430714 CTTTATCCACTCATGGTTGATGG + Intergenic
921350125 1:214226171-214226193 CTTTAAAAACTTATAGTTTAGGG + Intergenic
922945107 1:229507627-229507649 CATTAAACAATGATCTTTCAGGG + Intronic
1063551774 10:7040701-7040723 CTTATTTCACTGATGGTTCACGG + Intergenic
1064343610 10:14509469-14509491 TTTTAAACACTCGTGATTCAGGG + Intergenic
1064728258 10:18303013-18303035 CTTTAAACTCTGAAGCTTCACGG + Intronic
1069824514 10:71246869-71246891 CTTTAAACACTCCGGGTTCACGG + Intronic
1072840734 10:98771377-98771399 CACTAAACTCTGAGGGTTCAGGG - Intronic
1073721733 10:106180550-106180572 CATAAAGCACTTATGGTTCATGG - Intergenic
1073950447 10:108803048-108803070 TTTTAAACACCGATCTTTCATGG - Intergenic
1077238887 11:1500370-1500392 CTTTAAACACAGGCGGTTCACGG + Intronic
1079010163 11:16821339-16821361 CTTTAAACACTGGGAGGTCAGGG + Intronic
1079478647 11:20858227-20858249 CCTTAAACGGTGATGGCTCAGGG - Intronic
1079560461 11:21813613-21813635 CTTTAAACAGTTATGGCTCAGGG - Intergenic
1081086230 11:38804530-38804552 ATTTCTTCACTGATGGTTCAAGG + Intergenic
1081127980 11:39342873-39342895 CTTTAAACAGTGAAGGCTCAGGG + Intergenic
1082697336 11:56385500-56385522 CTTTATCCACTCATGGTTGATGG - Intergenic
1083475587 11:62912968-62912990 TTGTACACACTGAGGGTTCACGG - Intronic
1086989774 11:93290241-93290263 ATTTCCACAGTGATGGTTCAGGG - Intergenic
1088860081 11:113790920-113790942 CTTTATGCACTGAGGGATCATGG - Intergenic
1091194889 11:133722086-133722108 CTTCAAACACAGCTGGTTCTAGG - Intergenic
1092524573 12:9301898-9301920 CTACAAAGAGTGATGGTTCAAGG - Intergenic
1092542692 12:9429914-9429936 CTACAAAGAGTGATGGTTCAAGG + Intergenic
1094510320 12:31092515-31092537 CTACAAAGAGTGATGGTTCAAGG - Intronic
1095454259 12:42365613-42365635 CTGCAATCACAGATGGTTCAAGG + Intronic
1096116664 12:49059391-49059413 CTTTAAAGACTGGGGGTTCAGGG - Intronic
1098610782 12:72454860-72454882 CCCTAAACACAGATTGTTCATGG + Intronic
1098765650 12:74485441-74485463 CTTTAAACATAGATTGTTCCGGG - Intergenic
1098981875 12:76965020-76965042 CTTTAAAAACTGAAGCTTCAAGG - Intergenic
1100490032 12:95070444-95070466 CTTTATACACTGTTGGTGGAAGG + Intronic
1101395042 12:104339421-104339443 CTTTCAATACTGATTGCTCATGG + Intronic
1110235273 13:73211405-73211427 CTTTAAACACTGGTTGGTCCTGG + Intergenic
1110439678 13:75513675-75513697 CAATACACACTGATGGATCAGGG + Intergenic
1110747494 13:79071607-79071629 TTTTCAACATTGCTGGTTCATGG + Intergenic
1112128378 13:96495447-96495469 CTTTAAACACTGAGAGTTCGTGG + Intronic
1113417454 13:110139118-110139140 CTGAAAACACTCATTGTTCAGGG - Intergenic
1114209557 14:20603473-20603495 CTTTAAATGGTGATGGCTCAAGG - Intronic
1115202194 14:30866338-30866360 CTTGAAACAATGATCGTTTATGG - Intergenic
1118407943 14:65445293-65445315 CTGTAAACACTCATGGTGAAAGG - Intronic
1125060362 15:35413348-35413370 TATTAGAAACTGATGGTTCATGG - Intronic
1126195683 15:45927804-45927826 CTTTAAATCCTAATAGTTCAAGG + Intergenic
1126337925 15:47606662-47606684 CTTTATCCACAGATGTTTCAAGG + Intronic
1127306273 15:57708403-57708425 CTTTAATGACTGCTGGTTCTTGG + Intronic
1129158924 15:73736223-73736245 CTTTCAACACTGCTGAGTCATGG - Exonic
1130029921 15:80303951-80303973 TTTTAATCAATGATGTTTCAAGG + Intergenic
1131193812 15:90339027-90339049 CTTGAGATACTGCTGGTTCAAGG - Intergenic
1137022502 16:35442526-35442548 CTCCCAACACTGATGGTTCATGG + Intergenic
1137832897 16:51561160-51561182 CCTGAAACACTGAGGTTTCAAGG - Intergenic
1142719378 17:1766252-1766274 CTTTAAAAGCTATTGGTTCAGGG + Intronic
1149809274 17:59652276-59652298 CTAAGAACACTGATGATTCATGG - Intronic
1151104236 17:71594004-71594026 CTGTATACACTGTTGGTCCATGG + Intergenic
1151133152 17:71919220-71919242 CAGAAAACACTGATGGTACAGGG + Intergenic
1151778512 17:76226180-76226202 CTTTATGCACTGAGGGATCATGG + Intronic
1153314528 18:3708891-3708913 CTTTAAAAACAGATTTTTCAGGG + Intronic
1156632054 18:38982005-38982027 CTTGACACCCTCATGGTTCATGG + Intergenic
1158845763 18:61441109-61441131 CTTCAAAAACTGATTGATCATGG + Intronic
1159353012 18:67299578-67299600 CCTTAAACAGTGATGGCTCAGGG - Intergenic
1163842974 19:19622689-19622711 GTTTGAGCCCTGATGGTTCAAGG - Intergenic
926003233 2:9351313-9351335 TTTCAAACACTGAAGTTTCAAGG - Intronic
926231539 2:11007923-11007945 CATTAAGCACTGATGGGACAAGG + Intergenic
931280153 2:60783796-60783818 TTTTAAACACTGAAGCTCCATGG - Intronic
933652233 2:84858782-84858804 CTTTACACACTGAAGGTCCTGGG + Intronic
934372300 2:92763724-92763746 GTTTAAACACTGTTAGTTGAGGG - Intergenic
934375904 2:92821649-92821671 GGTTAAACACTGTTAGTTCAGGG - Intergenic
935436400 2:103039323-103039345 CTTTAAAAAATTATGGTTCATGG - Intergenic
936394421 2:112110821-112110843 CTGAAAACAATGATCGTTCAAGG + Intronic
936541598 2:113356119-113356141 GTTTAAACACAGATGGCCCAAGG - Intergenic
937353353 2:121182753-121182775 CTTTCAGCACTGATGGTTTGAGG - Intergenic
938942838 2:136184004-136184026 CTTAAAACCCAGATGGTTGATGG - Intergenic
939057570 2:137382820-137382842 CCTTAAACAGTGAAGGCTCAGGG - Intronic
940511616 2:154622711-154622733 CTTTAATCACAAATGGTGCAGGG + Intergenic
940604637 2:155904969-155904991 CTTTAAATATTCATGGTTTAAGG - Intergenic
942802604 2:179892876-179892898 TTTTAAGCACTGATGGTTTGGGG - Intergenic
943218334 2:185069337-185069359 CTTTAAACACAGGTGGCCCAGGG - Intergenic
945187966 2:207158781-207158803 CTTTTAAGACTACTGGTTCATGG - Intronic
945267964 2:207910154-207910176 CCTTCAACTCTAATGGTTCAGGG + Intronic
945697457 2:213125767-213125789 CTTTATACACTGATGATACATGG - Intronic
1168797862 20:623480-623502 CTGTAAACAGAGATGCTTCAAGG + Intergenic
1169160987 20:3378234-3378256 CTTTAGACACTGATGTCTGAGGG - Intronic
1169744655 20:8931456-8931478 CTTTACATATTGATGGTTTATGG - Intronic
1176294566 21:5064525-5064547 CTTTGAACAGTGATGGCCCAAGG + Intergenic
1177167304 21:17616885-17616907 CTTTAATCACTGCTGCTTTATGG - Intergenic
1177651575 21:23966429-23966451 CCTTAAACGGTGATGGCTCAGGG + Intergenic
1179862486 21:44197601-44197623 CTTTGAACAGTGATGGCCCAAGG - Intergenic
1180007601 21:45030147-45030169 CTCTAATCACAGATGGTTCCCGG + Intergenic
1181638926 22:24186875-24186897 CTGTCAGCACTGAGGGTTCAGGG + Intronic
1182946263 22:34325264-34325286 CTTTAAATGGTGATGGTTCAGGG - Intergenic
1183713854 22:39522151-39522173 CTTTATGCACTGAGGGATCATGG - Exonic
1185017637 22:48354002-48354024 CATGAACCACTGATGTTTCAGGG + Intergenic
949180727 3:1127877-1127899 CATGAAACACAGATTGTTCAAGG + Intronic
949241895 3:1883266-1883288 CTCTATACACTCACGGTTCATGG + Intergenic
949295624 3:2519171-2519193 CTTGAAACACAGTTGGTACAAGG - Intronic
949685309 3:6563122-6563144 ATTTAAGCCCTGAAGGTTCAGGG - Intergenic
955625249 3:60911524-60911546 CTTTAAACCCAGATCATTCATGG + Intronic
957212907 3:77284032-77284054 CTTTAAATATTGATGTATCAGGG + Intronic
959327992 3:104962303-104962325 CTTAAAACTCTGAAGCTTCATGG + Intergenic
959926525 3:111927772-111927794 CTTGATAAACAGATGGTTCAAGG - Intronic
960745783 3:120886884-120886906 ATCTAAACACTGGTGGTTCATGG + Intergenic
965366816 3:167811162-167811184 ATAAAAACACTGATGTTTCATGG - Intronic
967056299 3:185831803-185831825 CTTAAAATTCTGATGGTTCAAGG + Intergenic
968539594 4:1157897-1157919 TTCAAAACACTGATGATTCATGG - Intergenic
974752829 4:66163821-66163843 CTTAACACACTTCTGGTTCAAGG + Intergenic
974899923 4:67984360-67984382 CTATAAACTCTGAGGTTTCAGGG - Intergenic
975335193 4:73168299-73168321 CTATGAACACTAATTGTTCATGG - Intronic
975525767 4:75348961-75348983 CTTCATACATAGATGGTTCATGG - Intergenic
976780013 4:88748425-88748447 CTTTAACCACTGAAGGAGCAAGG - Intronic
976811796 4:89107157-89107179 CTTTAAACAGTGATGGCTCAGGG - Intronic
978016391 4:103751838-103751860 CCTTAAACAGTGAAGGCTCAGGG - Intergenic
978891614 4:113835167-113835189 CTTTATTCACTGCTGCTTCAAGG + Intergenic
981335082 4:143560233-143560255 CTTCAAAAACTGATAGTTAATGG + Intergenic
983146452 4:164221748-164221770 CTTGGAACACTGGTGTTTCAAGG - Intronic
983249551 4:165328407-165328429 CTTAAAACACTCAAAGTTCAAGG - Intronic
987095379 5:14545158-14545180 ATTTAAACACACATGGTTCATGG + Intergenic
988484292 5:31655691-31655713 ATTTAAACACTGATGCCCCAGGG + Intronic
989172891 5:38491066-38491088 CCTTTAACACTGAAGCTTCAAGG - Intronic
990191289 5:53263078-53263100 GTTTAAAGACTGATGGATCAGGG - Intergenic
991109442 5:62881806-62881828 TTTTAAACAGTCATAGTTCATGG + Intergenic
991489707 5:67170621-67170643 CTTTAAATACTGGTGTTTCCTGG + Intergenic
991728512 5:69560476-69560498 CTTTTAGAAATGATGGTTCAGGG + Intronic
991804943 5:70415623-70415645 CTTTTAGAAATGATGGTTCAGGG + Intergenic
991866441 5:71067399-71067421 CTTTTAGAAATGATGGTTCAGGG - Intronic
995409015 5:111833549-111833571 CAGTAAATACTGATGGTTTATGG + Intronic
995687225 5:114784020-114784042 CTTAGAACAGTGCTGGTTCAGGG + Intergenic
996444121 5:123524853-123524875 CCTTAAACACTGAAGGATAATGG + Intronic
996760877 5:126984578-126984600 CTTTAAACATTCTTGGGTCATGG + Intronic
1000411049 5:160935276-160935298 CCTTAAACAGTGAAGGTTCAGGG + Intergenic
1007781827 6:44258773-44258795 CTTTAAACAACGGTGTTTCAGGG + Exonic
1008522535 6:52375830-52375852 CTTTAAACACTGATGGTTCATGG + Intronic
1008781666 6:55113901-55113923 CTTTATCCACTGCTGGTTCATGG - Intronic
1011978385 6:93337319-93337341 CTTTACACACTGATTGCACAAGG + Intronic
1014202581 6:118622297-118622319 TTTGAAACACTGATCCTTCAAGG - Intronic
1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG + Intergenic
1016147962 6:140699818-140699840 CATAAAACATTAATGGTTCAGGG - Intergenic
1021802069 7:24316939-24316961 CTTCCAACTCAGATGGTTCAAGG - Intergenic
1024430075 7:49278107-49278129 CCTTAAACAGTGTTGGTACATGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1027997479 7:85443528-85443550 ATTTAAAAAATGATGTTTCAGGG + Intergenic
1029050339 7:97680231-97680253 CTTTAAACACCAATTGTGCAGGG - Intergenic
1031221875 7:118976780-118976802 CTTAAAACTCTGTTGTTTCAAGG - Intergenic
1031426857 7:121615685-121615707 CTTTACAGACTGAAGGTTAAAGG + Intergenic
1031944049 7:127819915-127819937 CTGTGAACACTGATTGTTAAAGG + Intronic
1033010636 7:137618944-137618966 ATTTAAAAACTGGTGGATCAGGG - Intronic
1035988598 8:4462315-4462337 CTTTAAACACTTATAGTTTTTGG - Intronic
1038124479 8:24656415-24656437 CTTTAAAGATTTCTGGTTCAAGG + Intergenic
1042052168 8:64723055-64723077 CTTTAAAGACTACTGATTCAGGG - Intronic
1042056582 8:64770504-64770526 CTTTACACACTGATTATTTAAGG + Intronic
1042880202 8:73479239-73479261 ATTTGAACACTGATGTTTGATGG - Intronic
1045513011 8:102829318-102829340 CATTAAAAGCAGATGGTTCATGG + Exonic
1045976829 8:108138773-108138795 CTTAGAACATTGCTGGTTCATGG - Intergenic
1050652308 9:7788143-7788165 CCTTAAACAGTGATGGCTCAGGG + Intergenic
1051999624 9:23261577-23261599 CTGTAAACACTCATAGTTCATGG + Intergenic
1055144603 9:72918027-72918049 CTGTAAATACAAATGGTTCATGG - Intronic
1057419047 9:94893845-94893867 CTTTATAAACTGACAGTTCATGG + Intronic
1060551316 9:124486699-124486721 CTTTAGAGACTGGGGGTTCAGGG - Intronic
1061055663 9:128221539-128221561 CTTTAAACCCAGAGGGTCCAAGG + Intronic
1061766650 9:132885874-132885896 CTTTGGACACTTCTGGTTCAGGG - Intronic
1193507669 X:82363404-82363426 ATTTAAATGGTGATGGTTCATGG + Intergenic
1195686414 X:107590737-107590759 ATTTATACACTGCTGGGTCATGG + Intronic
1195956338 X:110334970-110334992 CATTGCACACTGATGGTTAAGGG + Intronic
1196748110 X:119089661-119089683 CTCCAAACACTGATGCTTCTCGG - Exonic
1197401649 X:125999340-125999362 TTTTAAACACTGGTAGTGCAAGG + Intergenic
1198241721 X:134794361-134794383 CTTTGAACACTGCTGTTTGATGG + Intronic
1199552857 X:149077119-149077141 CCTTAAACAGTGATGGCTCAAGG - Intergenic
1199651482 X:149949124-149949146 TTTTAACCACAGTTGGTTCAGGG + Intergenic
1199973598 X:152878112-152878134 CTCTAAACACTGAAGGTGGAAGG - Intergenic