ID: 1008524768

View in Genome Browser
Species Human (GRCh38)
Location 6:52397018-52397040
Sequence CCCACCATCCCTGTCAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008524768_1008524772 -4 Left 1008524768 6:52397018-52397040 CCACAATTGACAGGGATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1008524772 6:52397037-52397059 TGGGAGAAGAAAGCCAAGGTGGG No data
1008524768_1008524774 6 Left 1008524768 6:52397018-52397040 CCACAATTGACAGGGATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1008524774 6:52397047-52397069 AAGCCAAGGTGGGGCCAGAGAGG No data
1008524768_1008524775 7 Left 1008524768 6:52397018-52397040 CCACAATTGACAGGGATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1008524775 6:52397048-52397070 AGCCAAGGTGGGGCCAGAGAGGG 0: 1
1: 0
2: 3
3: 53
4: 590
1008524768_1008524773 -3 Left 1008524768 6:52397018-52397040 CCACAATTGACAGGGATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1008524773 6:52397038-52397060 GGGAGAAGAAAGCCAAGGTGGGG No data
1008524768_1008524771 -5 Left 1008524768 6:52397018-52397040 CCACAATTGACAGGGATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1008524771 6:52397036-52397058 GTGGGAGAAGAAAGCCAAGGTGG No data
1008524768_1008524770 -8 Left 1008524768 6:52397018-52397040 CCACAATTGACAGGGATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1008524770 6:52397033-52397055 ATGGTGGGAGAAGAAAGCCAAGG 0: 1
1: 1
2: 1
3: 50
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008524768 Original CRISPR CCCACCATCCCTGTCAATTG TGG (reversed) Intronic
900173685 1:1282508-1282530 CACCCCATCCCTGTCTACTGTGG - Intronic
900409506 1:2506371-2506393 CCCACAATCCCTGTCAGTGCAGG - Intergenic
902752023 1:18522959-18522981 CCCACCATCCTTGTCCAGTCAGG + Intergenic
906036535 1:42753970-42753992 CCCACCATCCCTGCCCATGAGGG - Intronic
907668228 1:56451678-56451700 CCAACCAACTCTGTCCATTGAGG - Intergenic
911152227 1:94606884-94606906 CCCAGCCTCCCTTTCAGTTGAGG + Intergenic
911220191 1:95237257-95237279 CTCACCATCACTGTCAGTTTGGG + Intronic
911232036 1:95371805-95371827 CCCTGCATCCCTGTCATTTTTGG + Intergenic
911310517 1:96287288-96287310 GCCACCATCTCTTTTAATTGAGG + Intergenic
913692702 1:121294338-121294360 TTCCCCATCCCTGTGAATTGTGG + Intronic
914144854 1:144985752-144985774 TTCCCCATCCCTGTGAATTGTGG - Intronic
915801608 1:158799470-158799492 CTTACCATCCCTGACAACTGTGG - Intergenic
915943065 1:160130934-160130956 CCCACCCTCTCTGTCAACTTAGG + Intronic
917104433 1:171478207-171478229 CCCACCATCCCTGCAAATGTGGG + Intergenic
917266173 1:173223198-173223220 CACAGCAACCCTGTGAATTGAGG - Intergenic
920052601 1:203172772-203172794 GCCACCATCCCTGTCCCCTGGGG + Intronic
920480022 1:206312699-206312721 TCCCCCATCCCTGTGAATTGTGG + Intronic
920500539 1:206482415-206482437 CCCACCATGCCTGTCCATCCAGG - Intronic
1064112043 10:12547992-12548014 CCCTCCATCCCTGTCACCTGCGG + Intronic
1067083704 10:43227394-43227416 CCCACCACCTCTGTGCATTGGGG - Intronic
1070686711 10:78490193-78490215 CTCTCCAGCCCTGTCAATTCAGG - Intergenic
1073464544 10:103686645-103686667 ACCATCATACCTGTCAAATGGGG - Intronic
1075514446 10:123097949-123097971 CCCACTATCCCTGTCATTGGTGG - Intergenic
1076049997 10:127324804-127324826 ACCCCCTTCCCTGTCATTTGAGG + Intronic
1078020713 11:7654078-7654100 CCCACCATCCCCTTCACTGGGGG - Intronic
1079168464 11:18068838-18068860 CCCACCCTCCATGACAATTAAGG - Intergenic
1084340924 11:68500328-68500350 CCCACCATGCCTTCCATTTGTGG + Intronic
1085568150 11:77534407-77534429 ACCTCCATCCCTTTCAATAGCGG + Intronic
1090939037 11:131371777-131371799 CCCACCTGCCCTGTCCTTTGGGG + Intronic
1102658466 12:114503803-114503825 CCTCCCAGCCCTGTCAATTAGGG - Intergenic
1102958185 12:117073170-117073192 CCCTCCATCCCTGTCCTTGGAGG + Intronic
1103159152 12:118713134-118713156 CCCACCTTCCCAGCCAATGGTGG - Intergenic
1107976766 13:45695973-45695995 CCCCTCATCCCTCACAATTGAGG - Intergenic
1110246226 13:73327342-73327364 CCCACCTGCACTGTCAGTTGGGG - Intergenic
1113542798 13:111122121-111122143 CCCACCAACCCAGACAATGGTGG - Intronic
1117432822 14:55686584-55686606 GCCACCATCACAGTCAACTGAGG + Intronic
1117602596 14:57390724-57390746 CCCGCCAGCCCTGTCACTCGCGG - Intronic
1117964609 14:61193967-61193989 CCCACCATGGCTGTCTATTTGGG + Intronic
1119872771 14:78031174-78031196 CCAAACATCCCTGGCATTTGAGG + Intergenic
1121492086 14:94368233-94368255 ATCACCATCCCTGTGAGTTGAGG - Intergenic
1128378400 15:67093537-67093559 CCCAGCAGCCCTGTCAAGCGGGG + Intronic
1129000141 15:72326248-72326270 GCCACCTTCCCTTTCATTTGAGG - Intronic
1130016418 15:80189962-80189984 CACACCATGCCTGGCAATTTTGG + Intergenic
1133956426 16:10447622-10447644 CCCACCTCCCCCGTTAATTGGGG + Intronic
1134081152 16:11325977-11325999 CCCACCATCCCTGGCATCTGCGG + Intronic
1137672377 16:50286545-50286567 CCCACCTTCCCTTCCCATTGGGG + Intronic
1140976762 16:80067473-80067495 CCAACCATCCCTGGAAATGGGGG - Intergenic
1141298215 16:82789861-82789883 CCCACAATGCCTGTCCAGTGAGG - Intronic
1141664066 16:85456838-85456860 CCCACCGTCCCTGGCAATGGCGG - Intergenic
1141920649 16:87133427-87133449 CCCACCCTCCCAGCCACTTGCGG + Intronic
1142794044 17:2293030-2293052 CACCCCATCCCTGTCCTTTGAGG - Intronic
1146071325 17:29684553-29684575 ACCACCATACCTGTCATTAGAGG + Exonic
1147910759 17:43854547-43854569 CCCATCAGCCCTGTCAGGTGTGG - Intronic
1148764263 17:50028227-50028249 CCCAGCTTCCCTGGCAACTGGGG + Intergenic
1149341230 17:55688196-55688218 CCCACAATGCCTGGGAATTGTGG - Intergenic
1150158923 17:62877661-62877683 CCCACCAACCCTGTTATTTTGGG - Intergenic
1150634085 17:66900507-66900529 CCCACCATGCTTGGCAACTGTGG + Intergenic
1151317955 17:73335459-73335481 CCCACCACCCCTTTCTAATGTGG + Exonic
1151689395 17:75672304-75672326 CCCACCATCCCTGAGAGCTGGGG - Intronic
1153888063 18:9485221-9485243 GCCACCATGCCTGGCAACTGTGG + Intronic
1155591138 18:27428714-27428736 CCCACCATCCCAGTCACTGGTGG + Intergenic
1155871851 18:31040380-31040402 TCCACCATCCCTAACAATTCTGG + Intronic
1156229853 18:35142790-35142812 CCCACCATCCATGGGAAATGAGG - Exonic
1164539729 19:29113870-29113892 CCCATCATCCCTGTGCAATGGGG - Intergenic
1166122896 19:40696096-40696118 CACACCCTCACTGTCTATTGGGG + Intronic
1166224358 19:41385954-41385976 CCCACCAACCCTGTGAGATGGGG - Intronic
1166925425 19:46263775-46263797 CCCATCTCCCCTGACAATTGTGG + Intergenic
1167948618 19:53009214-53009236 CCAATCATCCCTGTAAATAGAGG + Intergenic
925764488 2:7217819-7217841 CCCACCATCCACCTTAATTGGGG + Intergenic
925975230 2:9137697-9137719 CCTTCCATCTCTGTCAAATGTGG - Intergenic
927857433 2:26536278-26536300 GCCACCATCTTTGTCAAATGGGG - Intronic
927927390 2:27023537-27023559 CCCACCAGCCCAGGCAACTGGGG + Intronic
930920709 2:56750309-56750331 CCCACCATGCTTGTACATTGTGG + Intergenic
935591103 2:104845810-104845832 CCCAACATTCCTGTGATTTGTGG - Intergenic
935828438 2:106974503-106974525 CCCAACATTCCTGGCAACTGTGG + Intergenic
946567343 2:220981348-220981370 ACCACCATCTCTGTCACCTGAGG - Intergenic
1171250277 20:23640994-23641016 CCCACCTTCCCTGGCCACTGGGG + Intergenic
1172786664 20:37473185-37473207 GCCACCTTCCCTGTCTATAGCGG - Intergenic
1174451895 20:50625727-50625749 GCAACCATGCCTGTCAACTGGGG + Intronic
1175583897 20:60122146-60122168 CCCACGTTCCCTGTCAAACGGGG + Intergenic
1178066336 21:28908430-28908452 GCCACCATGCCTGGCATTTGAGG + Intergenic
1178381900 21:32117019-32117041 CCCAGCATCCCTGTCACTGAGGG + Intergenic
1179520652 21:41942221-41942243 CCCACCTTTCCTGTCCTTTGAGG - Exonic
1184932769 22:47693449-47693471 CCCACAATCCCTGGAAACTGAGG - Intergenic
1185359668 22:50397986-50398008 CTCACCAGCCCTGTCATCTGAGG + Intronic
951684032 3:25324827-25324849 CCCTCCATCCCTGACAGTTCCGG + Intronic
953187581 3:40652930-40652952 TCCACCATCCATGTGACTTGGGG - Intergenic
953203569 3:40799926-40799948 CCATCCATCCCTGGCAATTTTGG + Intergenic
955205827 3:56895090-56895112 CCCTCCCTCCCTGTAATTTGGGG + Intronic
956805309 3:72804208-72804230 GCCACCATACCTGTCCATTAAGG + Intronic
958898757 3:99861086-99861108 CCCACCACCACTCTGAATTGGGG + Intronic
960441798 3:117697693-117697715 CCCGCTATGCCTGTCAATGGGGG + Intergenic
960965643 3:123102738-123102760 TGCACCATCCCTGTCAAATGAGG - Exonic
967930077 3:194684763-194684785 CCCACCATCCCAGTCCCCTGGGG - Intergenic
971330378 4:25676757-25676779 CCCCCCATCCCTGACAATCTGGG - Exonic
971541038 4:27817132-27817154 CCCCCCATCCCTGTAACTTTAGG - Intergenic
973862891 4:55083374-55083396 CCCAACATCCCTGTGAGCTGGGG - Intronic
973991612 4:56414042-56414064 CTGACCATTCATGTCAATTGGGG + Intronic
975922552 4:79409492-79409514 CCCAACACCCCTGACAAATGAGG + Intergenic
984091343 4:175378874-175378896 CCCACCTCAACTGTCAATTGTGG + Intergenic
984478213 4:180264757-180264779 CCCACAATACGTATCAATTGGGG + Intergenic
986382584 5:7201490-7201512 CACACCAAACCTGTCATTTGGGG - Intergenic
988481989 5:31639053-31639075 CCCCCCGTCCCTGTCACTCGGGG + Intergenic
991431108 5:66548398-66548420 TCCACCATCTCTGTCATTTCAGG + Intergenic
997024716 5:130045140-130045162 ACCACCATGCCTGTCAGTTTGGG + Intronic
997826138 5:137108564-137108586 CCCACTATCCTTGTCTTTTGGGG + Intronic
998882013 5:146654252-146654274 CCCACCTCCCCTGTAAAATGGGG - Intronic
999258558 5:150223293-150223315 CCCAGCAGCCCTCTCAATGGAGG + Intronic
1000919982 5:167126815-167126837 CCCAACATCCCAGGAAATTGTGG - Intergenic
1006458208 6:34143905-34143927 CCCTCCCTCCCTGTCACTTCGGG + Intronic
1007513991 6:42396771-42396793 CCCACCATCCCAGGCAGCTGAGG - Intronic
1007839543 6:44704532-44704554 CCCACCATTCCTGTCCACCGTGG + Intergenic
1008524768 6:52397018-52397040 CCCACCATCCCTGTCAATTGTGG - Intronic
1008664368 6:53701520-53701542 CCCACCATACCTGCCCATAGAGG + Intergenic
1013318875 6:108967356-108967378 CCCACCATCCTTGTTATTTATGG - Intronic
1022246429 7:28564351-28564373 CCAACCTTCACTTTCAATTGTGG + Intronic
1022259489 7:28690590-28690612 CCTACCTTCTCTGTGAATTGTGG + Intronic
1022343042 7:29486474-29486496 GTCACCATCCCTGGCAAATGGGG - Intronic
1023730283 7:43185134-43185156 CCCACCATCCCTGTCCTTTTGGG - Intronic
1026639215 7:72109737-72109759 CCTCCCATCCTTGGCAATTGGGG - Intronic
1027843831 7:83347009-83347031 CTCACCATCCCTGGTAATTAGGG + Intergenic
1032971891 7:137174512-137174534 ACCACAACCCCTGGCAATTGAGG + Intergenic
1037436286 8:18867018-18867040 TCCACCATGCCTGTTATTTGGGG - Intronic
1037658389 8:20906750-20906772 TCCACCATCCATGACAGTTGTGG + Intergenic
1040512203 8:48105515-48105537 CCCACCATCCCTGTGGCCTGAGG - Intergenic
1040816379 8:51512318-51512340 CCCACCATCCGTGTCATGTCAGG - Intronic
1041708497 8:60871821-60871843 CCCACCATCAATGTTAATTCAGG + Intergenic
1045016176 8:98003557-98003579 CCCACCAGCCCTCTCCATGGGGG + Intronic
1046629227 8:116606901-116606923 CCAAACATTCCTGTCAAGTGAGG + Intergenic
1052486923 9:29113444-29113466 CAGACCATCCATGTCAATTTTGG + Intergenic
1053315332 9:37046295-37046317 ACCACCATCCCTTCCAAATGGGG - Intergenic
1061410061 9:130415730-130415752 CCCACAATCCCTGGCCATCGTGG - Intronic
1062244140 9:135555164-135555186 TCCACCATCACTGTCATTTCTGG + Intergenic
1203699080 Un_GL000214v1:120876-120898 TCCACCCTCCCTGGAAATTGGGG - Intergenic
1203700034 Un_GL000214v1:127186-127208 TCCACCCTCCCTGGAAATTGGGG - Intergenic
1203700945 Un_GL000214v1:133170-133192 TCCACCCTCCCTGGAAATTGGGG - Intergenic
1203479778 Un_GL000224v1:1750-1772 TCCACCCTCCCTGGAAATTGGGG - Intergenic
1203480745 Un_GL000224v1:8046-8068 TCCACCCTCCCTGGAAATTGGGG - Intergenic
1203481706 Un_GL000224v1:14376-14398 TCCACCCTCCCTGGAAATTGGGG - Intergenic
1203569378 Un_KI270744v1:117124-117146 TCCACCCTCCCTGGAAATTGGGG - Intergenic
1203570328 Un_KI270744v1:123405-123427 TCCACCCTCCCTGGAAATTGGGG - Intergenic
1186197659 X:7125891-7125913 CCCACAATTCCTGTGTATTGTGG - Intronic
1187787500 X:22908799-22908821 CACAACCTCCCTGTCAATTAAGG + Intergenic
1190593757 X:52032493-52032515 CCCAGAATCACTGTCAATTTAGG - Intergenic
1192141775 X:68652403-68652425 CCCACCATCCCTGGCTTCTGGGG - Intronic
1194036271 X:88876204-88876226 GCCACCATCCATGTAAAATGTGG + Intergenic
1194662797 X:96645270-96645292 CTCATCATCCCTGACAATGGAGG + Intergenic
1196481082 X:116149766-116149788 CCCACCCATCCTGTCCATTGTGG + Intergenic