ID: 1008524774

View in Genome Browser
Species Human (GRCh38)
Location 6:52397047-52397069
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008524768_1008524774 6 Left 1008524768 6:52397018-52397040 CCACAATTGACAGGGATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1008524774 6:52397047-52397069 AAGCCAAGGTGGGGCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type