ID: 1008530874

View in Genome Browser
Species Human (GRCh38)
Location 6:52457282-52457304
Sequence GGTCAGAAGGACAAAGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008530868_1008530874 20 Left 1008530868 6:52457239-52457261 CCAGATTATCTGATTATGTAATT 0: 1
1: 0
2: 1
3: 24
4: 307
Right 1008530874 6:52457282-52457304 GGTCAGAAGGACAAAGGTGTGGG 0: 1
1: 0
2: 3
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008530874 Original CRISPR GGTCAGAAGGACAAAGGTGT GGG Intronic
901035055 1:6331479-6331501 GGCCAGAAGTGCAAAGGTATGGG - Intronic
901412958 1:9097798-9097820 GGTCAGAAGGAAGATGGAGTTGG - Intergenic
904159346 1:28511260-28511282 TGTAATAAGGACAAAGGAGTTGG + Intronic
904344973 1:29861777-29861799 GGACACAAGGAGAAAGGGGTGGG + Intergenic
906229272 1:44146936-44146958 GGTCAGAAATTCAAAGATGTAGG - Intergenic
908235310 1:62142372-62142394 GGTTACAAGGAGATAGGTGTTGG - Intronic
908817395 1:68048367-68048389 GGTCAGATGGAAAAAGTTCTAGG + Intronic
912553266 1:110498040-110498062 GGTCGGAGAGACAAATGTGTTGG + Intergenic
913393107 1:118336150-118336172 GGTCACATGGCCAAAGCTGTAGG + Intergenic
915167620 1:153957457-153957479 GGTCAGAGGGACCAAGGGGTAGG - Intronic
917246917 1:173013404-173013426 GCTCAGAAGGAAAGAGTTGTAGG + Intergenic
917770759 1:178275264-178275286 GCTCAGAAGATCAAAGCTGTAGG - Intronic
920380775 1:205533354-205533376 GGGCAGCAGGACGAGGGTGTGGG + Intergenic
921753370 1:218823827-218823849 GGTAAGAAGAACACAGGTTTTGG + Intergenic
921771757 1:219048755-219048777 TGTCAGAAGGACACAGGCTTTGG + Intergenic
922564711 1:226594154-226594176 GATCTGAAGCACAAAGGTGTGGG + Intronic
1063265805 10:4449324-4449346 GGTCAGAAGGATTAAGGTCAGGG - Intergenic
1063267388 10:4468883-4468905 GTTCAAAAGGTGAAAGGTGTGGG - Intergenic
1064474358 10:15670928-15670950 GGTCAGACAGACAAAGGGGCAGG - Intronic
1066237217 10:33497412-33497434 GATTAGAAGGAGAAAGATGTTGG + Intergenic
1066297973 10:34072156-34072178 GGTAAGAAGAACAAAGCTGCAGG + Intergenic
1067295293 10:44972131-44972153 GTTCACATGGACAAAGGTCTCGG - Intronic
1067402375 10:45988535-45988557 CTTCAGAGGGACAAAGGTGAAGG - Intronic
1067526468 10:47042256-47042278 GGGCAGAAGGACAAAGGGTCAGG + Intergenic
1067870725 10:49958168-49958190 CTTCAGAGGGACAAAGGTGAAGG - Intronic
1068393966 10:56437121-56437143 GGACAGAAGGACAGAAGGGTAGG + Intergenic
1068412151 10:56669864-56669886 AGTAAGAAGGAAAAATGTGTTGG + Intergenic
1069070971 10:63990385-63990407 GGTCAGAAGGAGACAGGGGCAGG - Intergenic
1070610636 10:77929915-77929937 GGTGAGAAGGACAAAGACGGGGG + Intergenic
1071602073 10:86963174-86963196 GGTCAGAAGGACCAGAGGGTGGG - Exonic
1072652178 10:97304245-97304267 GGTCAGAAGGCCACAGGGGCTGG + Intergenic
1073050119 10:100661787-100661809 CATAAGAAGGACGAAGGTGTGGG + Intergenic
1073418685 10:103406093-103406115 AGACAGAAGAACAAAGGTGAGGG + Exonic
1074497603 10:113993650-113993672 GGTCAGAAAGCCAGTGGTGTGGG - Intergenic
1075148741 10:119906995-119907017 GGTCAGAAGTACAAAAGACTAGG + Intronic
1076169527 10:128307900-128307922 AGAGAGAAGGACAAAGGTGGAGG - Intergenic
1078331655 11:10427262-10427284 GCTCAGAAAGACAAACGTATTGG + Intronic
1079455059 11:20629241-20629263 GTTGAGAAGGACAAAGGGGCAGG - Intronic
1079576680 11:22012226-22012248 GTTCAGGAGGCCAAAGGTATAGG + Intergenic
1080129883 11:28781593-28781615 GCTCAGAAGAAAAAAGATGTGGG - Intergenic
1082821925 11:57549923-57549945 GAGCAGAAGGTCAAAGGTGAAGG - Intronic
1084365294 11:68693585-68693607 GGTCAGCAGCACAAAGGTGTCGG + Intergenic
1084769856 11:71335537-71335559 GTTCAGAAGGACCAAAGGGTGGG - Intergenic
1084964476 11:72737354-72737376 GGACAGAAGGGCAAAAGTTTTGG - Intronic
1086583983 11:88431224-88431246 GCTCAGCAGGAAAAAGGGGTTGG + Intergenic
1089898895 11:121960779-121960801 AGGCAGAAGGAAAAAGGTGCTGG + Intergenic
1090475045 11:127012752-127012774 GGGCAGAAGGGAAAAGGTGAGGG + Intergenic
1090857941 11:130627081-130627103 AAAAAGAAGGACAAAGGTGTAGG + Intergenic
1091463205 12:661571-661593 GTTCAGAAGGAAAGAGGTGGTGG - Intronic
1091847619 12:3669533-3669555 GTGCAAAAGGACAAGGGTGTGGG + Intronic
1092216316 12:6685973-6685995 GGTCAGATAGACAAAGCTCTGGG - Intronic
1093175434 12:15908331-15908353 GGTCAGATGGAGAAAAGTGTAGG - Intergenic
1094488515 12:30943838-30943860 GCACAGAAGGACAAGGCTGTTGG + Intronic
1094770480 12:33652564-33652586 GGTTAGAAGTAAAAAGGAGTTGG + Intergenic
1098576340 12:72047155-72047177 GGTGAGAACCACAAAGATGTAGG + Intronic
1100207472 12:92366452-92366474 GTTCAGAAAGACATAGGTCTGGG - Intergenic
1100374720 12:94003749-94003771 GGTAAGAAGAACAAAGCTGGAGG - Intergenic
1100396922 12:94193783-94193805 GACCAGATGGACAGAGGTGTCGG + Intronic
1100774766 12:97961851-97961873 TGTATGAAGGACAAAGGAGTGGG + Intergenic
1102809317 12:115810356-115810378 GGTGAGAAGTCCAAAGGTCTTGG - Intergenic
1103681304 12:122696282-122696304 GGTCAGAAGGATGAGGTTGTTGG + Intergenic
1103683034 12:122709707-122709729 GGTCAGAAGGATGAGGTTGTTGG + Intergenic
1104559238 12:129829011-129829033 GTTCAGAAGCACAGTGGTGTTGG - Intronic
1105272068 13:18886222-18886244 GGAGAGAATGACAAAGGTGTGGG + Intergenic
1108046576 13:46389066-46389088 AATCAGAAAGAAAAAGGTGTGGG + Intronic
1109119498 13:58436375-58436397 GGTGAGAAAGACAAAAGTGTTGG - Intergenic
1109843595 13:67953207-67953229 AGACAGAAGGACGAATGTGTGGG + Intergenic
1111410703 13:87873104-87873126 GGTCAGAAGCACAGAGATATAGG + Intergenic
1111749933 13:92316229-92316251 GGATAGAAAGAAAAAGGTGTTGG - Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112202007 13:97285871-97285893 GGTCAGAAGGAAAAAGATTCAGG - Intronic
1113013824 13:105804812-105804834 GGTCAGGTGGACAAAGATGTTGG - Intergenic
1113859648 13:113472962-113472984 GGACAGAAGGACAGAGGTACGGG - Intronic
1116454567 14:45104568-45104590 GGTCAGAAGGATAGAGGAGGAGG + Intronic
1116928185 14:50662966-50662988 GGTTTGAAGGACAAAGGAGAGGG - Intronic
1117852105 14:59984615-59984637 GGACAGAAGGTCAAAGGAGGAGG - Intronic
1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG + Intergenic
1120458372 14:84760991-84761013 GGGCATAAGGACCAATGTGTAGG - Intergenic
1121362269 14:93272462-93272484 GTTCTGAAGGACAAATCTGTAGG - Intronic
1121783997 14:96640859-96640881 GGTCAGATTGACAAGGGTGGAGG + Intergenic
1122359934 14:101153112-101153134 GGTAAGAAGGACAATGGGGCAGG - Intergenic
1122362407 14:101175186-101175208 GGGCAGGAGGCCAGAGGTGTGGG + Intergenic
1122794759 14:104200682-104200704 GGTCTGAAGGTCACAGGTGCAGG + Intergenic
1122849644 14:104520809-104520831 GGTCTCAAGGACAAAAGTGGTGG + Intronic
1123486510 15:20744876-20744898 GGAGAGAATGACAAAGGTGAGGG + Intergenic
1123542998 15:21313926-21313948 GGAGAGAATGACAAAGGTGAGGG + Intergenic
1123843230 15:24269988-24270010 GGGCAGACAGGCAAAGGTGTTGG - Intergenic
1127610611 15:60632431-60632453 GGTCAGATAGACTTAGGTGTAGG + Intronic
1127900996 15:63340852-63340874 TATCAGAAGGGCAAAGCTGTGGG + Intronic
1129417257 15:75392520-75392542 GTTAAGAAGCACAATGGTGTTGG - Exonic
1129737583 15:77974802-77974824 GGGAAGAAGGGCAAAGGTGATGG - Intergenic
1130253439 15:82315133-82315155 GGGAAGAAGGGCAAAGGTGATGG - Intergenic
1130851655 15:87800659-87800681 GGTCAAAAGAACAAAGGAGCAGG - Intergenic
1131576918 15:93601487-93601509 GGTCAGAAGCCCAAATGAGTTGG + Intergenic
1132156137 15:99496374-99496396 GGGCAGAAGGACAGAGGGGCAGG + Intergenic
1202951317 15_KI270727v1_random:41056-41078 GGAGAGAATGACAAAGGTGAGGG + Intergenic
1134442730 16:14308827-14308849 GGACAGAAGGACTAAGGCTTGGG - Intergenic
1134822840 16:17260554-17260576 GTTCCCAAGGAAAAAGGTGTCGG + Intronic
1135818343 16:25656444-25656466 GGTAAGAAGGATAACGGTATAGG + Intergenic
1137724580 16:50648350-50648372 GGGCAGAAAGACAGAGGTGTTGG - Intergenic
1137879060 16:52027259-52027281 GGGCAGTAGGACAATGGGGTAGG - Intronic
1138920174 16:61517932-61517954 GGAGAGAAGGACAATGGTGGTGG - Intergenic
1139081804 16:63530809-63530831 GATCAGAAGGACAAATAAGTGGG - Intergenic
1139510947 16:67428360-67428382 GCTCTGGAGGACAAAGGGGTGGG - Intergenic
1139573689 16:67828452-67828474 GGTGAGAAGGCGGAAGGTGTGGG - Exonic
1142548938 17:725870-725892 TGTCAGAAGAACAAAGGTGGGGG - Intergenic
1142901665 17:3015960-3015982 ATGCAGAAGGACTAAGGTGTGGG - Intronic
1143310010 17:5980051-5980073 GGTGAGAAGGACAACCCTGTGGG - Intronic
1143733642 17:8895466-8895488 GGTCAGGAGGGCAGAGGGGTTGG - Intronic
1143916873 17:10300614-10300636 TATCAGAAAGACAAAAGTGTTGG - Intronic
1144666328 17:17104829-17104851 GGTCTTAAGGACAAAGCTGGTGG - Intronic
1144888996 17:18483287-18483309 GGTCAGGAGGGCAAAGGTCACGG + Intronic
1145143212 17:20461009-20461031 GGTCAGGAGGGCAAAGGTCATGG - Intronic
1148600867 17:48893234-48893256 GGTCAGAGGGACAGAGCAGTGGG - Intronic
1148943970 17:51241955-51241977 TGTCAGAATGACACAGGAGTAGG - Intronic
1150306308 17:64088256-64088278 GGTCAGAAAGAACAAGGTGGAGG - Intronic
1151712297 17:75813719-75813741 GGTCAGATGGAGAAAGGAGAAGG - Intronic
1152254219 17:79228020-79228042 GGTCAGAAGGACCCAGGTGTGGG + Intronic
1152637208 17:81435065-81435087 GGGCTGAAGGACAGAGGAGTGGG - Intronic
1154253956 18:12767021-12767043 GGTCATAAGGGCAAACCTGTGGG + Intergenic
1156239020 18:35233498-35233520 GGTCAGAAGAAGGAAGATGTTGG + Intergenic
1157754965 18:50209795-50209817 GGCCATAAGGACAACGGTGGGGG - Intergenic
1157883365 18:51342892-51342914 GGTGAGAAGGAGAGAGGTGCTGG + Intergenic
1158281181 18:55829729-55829751 GTTCAGAAGGAAAAAGATGTGGG - Intergenic
1163614930 19:18321420-18321442 GGTTAGAAGCACAATGGAGTCGG - Intronic
1164730375 19:30499763-30499785 GGCCAGGAGGAGAAAGGTCTTGG + Intronic
1165542280 19:36501965-36501987 GGTCAGAAGGATAAAAGAGAAGG - Intergenic
1166804137 19:45474808-45474830 GGTCAGATGGACACAGGCGGAGG - Exonic
925458952 2:4043493-4043515 GGTCAGCAGGACAGAGGGGAGGG - Intergenic
925461904 2:4070427-4070449 GGTGAGAAGGACACAGGGTTCGG - Intergenic
926315307 2:11705251-11705273 GCTCAGAAGGTCAAAGGACTTGG - Intronic
927511165 2:23644615-23644637 GATCAGAAAGACACAGGTGGCGG + Intronic
928163877 2:28955287-28955309 GAGCAGATGGAGAAAGGTGTGGG - Intergenic
929839750 2:45445987-45446009 AGTCAGAAGGAAGAAGTTGTAGG + Intronic
931786078 2:65620563-65620585 GGACAGAAGGACAAAGAAGGGGG - Intergenic
932449162 2:71798674-71798696 AGGCAGAAGGTCAAAGGTCTTGG + Intergenic
938169411 2:129061580-129061602 GGCCAGCAGGGCAATGGTGTGGG - Intergenic
938928301 2:136064240-136064262 GGTCAGAAGGAGGAAGATGAGGG - Intergenic
940665227 2:156600938-156600960 GATCAGAATGACAATGGTGGTGG - Intronic
942983033 2:182105483-182105505 AGAGAGAAGGGCAAAGGTGTGGG + Intronic
943718808 2:191181303-191181325 CGACAGAAGGACAAAGGGCTTGG - Intergenic
945576344 2:211534704-211534726 GATAAAAAGGACAAAGGAGTAGG + Intronic
947365852 2:229394308-229394330 GGTCCGAAGGGTAATGGTGTGGG + Intronic
947544273 2:231000337-231000359 GGACAGAAGGAGAGAGGTGAGGG - Intronic
1169086968 20:2832700-2832722 AGTTTTAAGGACAAAGGTGTTGG + Intergenic
1172187522 20:33040355-33040377 GATCAGAAGGCCAAATGTGAAGG - Intronic
1172320381 20:33991801-33991823 GGTCTGAAGGACAAAATTTTAGG - Intergenic
1172670465 20:36631564-36631586 GGGCAGAAGGCCAAATGTGAAGG - Intronic
1173562977 20:44019533-44019555 GGTTAGGAGGGCAAAAGTGTTGG + Intronic
1173785584 20:45790816-45790838 GGTTAGAGGGACAAAGATGTAGG - Intronic
1173964894 20:47105175-47105197 GGTCATAAGAACAAAGGTGGAGG - Intronic
1174844732 20:53933092-53933114 CAACAGAAGGACAAATGTGTCGG - Intergenic
1175245368 20:57579019-57579041 GGTGAGCAGGACACAGGTGATGG - Intergenic
1175739491 20:61410788-61410810 GGATGGAAGGACAAATGTGTGGG - Intronic
1177974048 21:27825754-27825776 GGTCAGGAGAGAAAAGGTGTTGG - Intergenic
1178581649 21:33843411-33843433 GGAGAGAAGGACAAAGGGCTGGG - Intronic
1179770557 21:43612298-43612320 GGCCAGGATGACACAGGTGTTGG + Intronic
1181527200 22:23496702-23496724 GGTGAGGAGGCCAGAGGTGTGGG + Intergenic
1182246835 22:28964832-28964854 GGTATGAAGGACAAAGCCGTGGG + Intronic
1182381520 22:29893514-29893536 GGAGAGAATGACAAAGGTGAGGG - Intronic
1183611205 22:38907613-38907635 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1184681507 22:46074704-46074726 GGCCACAAGGACTATGGTGTGGG + Intronic
949435640 3:4026372-4026394 TTTCAGAAGGACATAGGCGTGGG - Intronic
950686471 3:14621954-14621976 GCTCAGAAGCACTCAGGTGTGGG + Intergenic
953769147 3:45765483-45765505 GGTCAGGAGGGCCAAGGCGTGGG - Intronic
953966750 3:47313517-47313539 GGGCAAAAGGAAAAAGTTGTGGG - Intronic
954111048 3:48433318-48433340 GGTCAGAAGGGCAAAGGAATTGG + Intronic
955888910 3:63630044-63630066 GGTCAGTAGGACTAAGGAGGTGG + Intergenic
957489863 3:80909695-80909717 GGTTAGAAGAACAAAGCTGGAGG + Intergenic
958069941 3:88597246-88597268 GCTCAGAAGGAGAGAGCTGTAGG + Intergenic
958848148 3:99290036-99290058 AGCCAGAAGGACAAAGCTGGAGG - Intergenic
959018457 3:101162609-101162631 GGTCACAAGTACAAATGTTTAGG - Intergenic
959507302 3:107170566-107170588 GGTCAGAAAAAGAAAGATGTGGG + Intergenic
960608270 3:119530609-119530631 GGTGGGGAGGAGAAAGGTGTTGG + Intronic
961933562 3:130559388-130559410 TGTCAGAAGGACAGTGATGTAGG + Intergenic
961969544 3:130945878-130945900 GGTCAGATGGAAAAAGGTTGTGG + Intronic
963262933 3:143211065-143211087 TGTCAGAAGGAGAAAGGAGCAGG + Intergenic
963756977 3:149244816-149244838 GGGCAAAAGCACAAAGGTGAAGG - Intergenic
964088310 3:152845158-152845180 TGTCAAAAGGACAAAGGAGAAGG + Intergenic
964646251 3:158961093-158961115 GGAGAGAAGGAGAAAGGGGTGGG - Intergenic
964741760 3:159974115-159974137 GGTCAGAAGTACACAAGTGCAGG + Intergenic
966345805 3:178978484-178978506 GGTCTGAGGGATAATGGTGTAGG - Intergenic
967339344 3:188378953-188378975 GGTGAGAAGGGGAAGGGTGTGGG + Intronic
968719086 4:2186380-2186402 GGTCAGTAGGACCATGTTGTAGG + Intronic
971317735 4:25581351-25581373 CGTCAGCAGGACAAACGTGCAGG - Intergenic
973335440 4:48951222-48951244 GGTCAGAAGGACAAGAGAGTAGG + Intergenic
975864022 4:78707424-78707446 TGTCTGAAGGTCAAAGGGGTGGG - Intergenic
976159983 4:82188822-82188844 GGTAAGAAGAACAAAGCTGGAGG + Intergenic
977505767 4:97901864-97901886 AGTAAGAAGGACAAAGTTGCAGG + Intronic
978203268 4:106048198-106048220 AGTCAAAAGGATAAAGGTCTCGG + Intronic
978260201 4:106747017-106747039 TTTCAGAAGGAAAAAGTTGTGGG - Intergenic
978506043 4:109457477-109457499 TGGCAGAAGGGCAAAGGTGAGGG + Intronic
979253500 4:118589148-118589170 GGTCACAAGGAAAGAGGTGAGGG - Intergenic
979366987 4:119837237-119837259 AGTCAGAAGGCCATTGGTGTGGG + Intergenic
981366428 4:143909313-143909335 GGTTTGAAGGACAAAGGAGAGGG - Intergenic
983462000 4:168037044-168037066 AGTGAGAAGGACAATGGTATGGG + Intergenic
984694719 4:182767971-182767993 GGTGAAAATGACAGAGGTGTGGG + Intronic
985494710 5:198012-198034 GGGCAGAAGGAGAAAGGGGATGG - Exonic
985931015 5:3057945-3057967 GGTCAGAGGCACAAGGGTGGTGG + Intergenic
986407191 5:7437905-7437927 GGTCAGAAGAACAAAGGAAAGGG - Intronic
987342777 5:16953297-16953319 GGTCAAAAAGAGAAAGCTGTGGG - Intergenic
988282852 5:29172816-29172838 GGTGAGAAGGCCAGAGGGGTAGG - Intergenic
988321484 5:29703664-29703686 GGGCAGAAGGACAACTGTATTGG - Intergenic
990628048 5:57636334-57636356 GGGCAGAAGGACGCAGGTGTGGG + Intergenic
991050756 5:62270801-62270823 AGTCAGAAGGGCATAGGTTTAGG - Intergenic
995474794 5:112536953-112536975 GGTCATAAAGAATAAGGTGTAGG + Intergenic
995992714 5:118262381-118262403 AGTTAGAAGGACGAATGTGTGGG + Intergenic
996123001 5:119692155-119692177 GCTCAGAAGAAGAAAGATGTGGG - Intergenic
999197686 5:149793603-149793625 GGTCTGAAGGAGAATGGTTTGGG - Intronic
1000044768 5:157513032-157513054 GGTCAGAAGGACAGTGTTCTGGG + Intronic
1000551858 5:162675953-162675975 GGTCAGAAGAACATGGGTGGTGG + Intergenic
1001467748 5:171983453-171983475 GGTCAGAAGGACAAAAGCCCAGG + Intronic
1001534083 5:172486423-172486445 GGGCAGAAGGACAAGAGCGTTGG + Intergenic
1004073718 6:12326108-12326130 GGGAAGAAGGAGAAAGGTGAGGG + Intergenic
1004750266 6:18555245-18555267 AGGCAGAATGACAAAGGTATTGG + Intergenic
1004898354 6:20170639-20170661 GATCAGAAGGACTAAGGGGGAGG - Intronic
1004904443 6:20223247-20223269 GGTGATAAGGACAAAGGCATGGG + Intergenic
1006343029 6:33457340-33457362 GGTCAGAGGGACTCAGGTTTGGG + Exonic
1007589297 6:43011858-43011880 GGTCAAAAGGAGAAAAGTATAGG + Exonic
1007825256 6:44595235-44595257 GGTCAGCAGGACAATGGTGTAGG - Intergenic
1008530874 6:52457282-52457304 GGTCAGAAGGACAAAGGTGTGGG + Intronic
1009321685 6:62298269-62298291 GGTCAGAAGGTAAAAGGGGTTGG - Intergenic
1013055407 6:106577907-106577929 GGTCAGAAGTCCAAATGTATGGG - Intronic
1013260653 6:108438268-108438290 GGCTAGAAGGACAAAGACGTTGG + Intronic
1013623077 6:111909233-111909255 GGGCAGAAGGGCAGAGGTGCAGG - Intergenic
1014398866 6:120962383-120962405 TTTCAAAAGGACATAGGTGTAGG + Intergenic
1016412470 6:143797836-143797858 GGCAAGAAGGACAAAGCTGGAGG - Intronic
1016886567 6:148964870-148964892 CTTAAGAAGAACAAAGGTGTTGG + Intronic
1019704683 7:2491851-2491873 GGACAGAAGGACTGATGTGTGGG - Intergenic
1019704690 7:2491890-2491912 GGACAGAAGGACTGATGTGTGGG - Intergenic
1019704755 7:2492178-2492200 GGACAGAAGGACTGATGTGTGGG - Intergenic
1019704768 7:2492245-2492267 GGACAGAAGGACTGATGTGTGGG - Intergenic
1019704787 7:2492337-2492359 GGACAGAAGGACTGATGTGTGGG - Intergenic
1019704843 7:2492662-2492684 GGACAGAAGGACTGATGTGTGGG - Intergenic
1019724447 7:2593406-2593428 GGTCAGAACCACCCAGGTGTGGG + Intronic
1020739748 7:11999515-11999537 AGACAGAAGGACAGAGGTGGGGG + Intergenic
1023308545 7:38857047-38857069 GGTTAGATGGACAGAGGTCTGGG + Intronic
1028384705 7:90242029-90242051 GGTGAGAAGGACAAGGGTAGAGG - Intergenic
1031537003 7:122946930-122946952 GGTAGGAAGGACAATTGTGTAGG + Intergenic
1031756751 7:125653811-125653833 TATCAGAAAGACAAAGGTGTTGG - Intergenic
1033728434 7:144147204-144147226 GGTCAGGAGGCCAAAGCTGCTGG - Intergenic
1034972574 7:155428299-155428321 GGCCAGATGGGAAAAGGTGTGGG - Intergenic
1035157554 7:156926310-156926332 GGTCAGAGGGACAAGGCGGTTGG - Intergenic
1036132986 8:6133612-6133634 GGTAAGAAGGAGGCAGGTGTGGG - Intergenic
1037177155 8:15961423-15961445 GGGCCGGAGGACAAAGCTGTGGG - Intergenic
1037540172 8:19863121-19863143 TGTGAGAAGGACAAATTTGTGGG + Intergenic
1037679804 8:21087705-21087727 GGTAAGAAGGACAAGGGTCAGGG + Intergenic
1037884264 8:22588163-22588185 GGTCAGAAGGGCAAAGTAGCTGG - Intronic
1040355375 8:46612581-46612603 GGTAAGAAGAACAAAGCTGGAGG + Intergenic
1040680037 8:49797742-49797764 GGTTAGAAGGAAGAAGGGGTCGG - Intergenic
1043129011 8:76437860-76437882 GGTAAGAAGAACAAAGCTGGAGG - Intergenic
1046570133 8:115952910-115952932 GCTCAGAAAGACATTGGTGTTGG - Intergenic
1047036876 8:120949579-120949601 GGTCAAATTGACATAGGTGTTGG + Intergenic
1047246246 8:123147576-123147598 AGGCAGAGGGGCAAAGGTGTAGG - Intronic
1047982953 8:130202327-130202349 GGAAAGATGGACAAAGGTATAGG - Intronic
1048141774 8:131801956-131801978 GGTGAGAAGGAGACAGGTGAGGG + Intergenic
1048457768 8:134593316-134593338 TGTCAGAAGGACACAGATGGTGG + Intronic
1049137679 8:140918913-140918935 TGTGATAAGGACAAAGATGTTGG - Intronic
1049605949 8:143529255-143529277 GGACAGAGGGACAGAGGGGTAGG + Intronic
1050431758 9:5569322-5569344 GGTCTGAAGGAGAAAGGGGAGGG + Intronic
1051446962 9:17150588-17150610 GGCAAGAAGGACAAAGCTGGAGG - Intronic
1051524913 9:18032348-18032370 GGTCCAGAGGACAAAGCTGTGGG - Intergenic
1051869809 9:21724945-21724967 GGTGAGAAGGACTTAGGTGAAGG + Intergenic
1053605640 9:39655815-39655837 TTTAAGAAGGAAAAAGGTGTGGG + Intergenic
1053863559 9:42412445-42412467 TTTAAGAAGGAAAAAGGTGTGGG + Intergenic
1054247903 9:62686600-62686622 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1054562017 9:66721125-66721147 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1055223932 9:73970750-73970772 TGTGAGAAGGACAAAGGATTTGG + Intergenic
1055673036 9:78626339-78626361 GGTCTGAAGGACAAAGCTCAGGG - Intergenic
1055785333 9:79864435-79864457 GGCCGGAAGGAGAAAGGTGTGGG - Intergenic
1056096494 9:83259872-83259894 GGTAAAAAGGAGAAAGGTGAAGG + Intronic
1058252801 9:102722593-102722615 AGTCAAAAGAACAAAGCTGTAGG + Intergenic
1058930081 9:109710172-109710194 GGCCAGAAGTCCTAAGGTGTTGG - Intronic
1059437484 9:114285375-114285397 TGCCAGAAGGTCCAAGGTGTTGG + Intronic
1061231247 9:129317033-129317055 GCTCATAAGGACCAATGTGTTGG + Intergenic
1061390840 9:130316308-130316330 GGGCAGATGGACACAGGGGTAGG + Intronic
1186983067 X:14979070-14979092 GGTCAGAAAGAGACAGGTGGAGG + Intergenic
1187293935 X:17981003-17981025 GGGCAGAAGGAGTAAGGGGTGGG - Intergenic
1187684307 X:21801055-21801077 TGGCAGAAGGACCAAGTTGTTGG - Intergenic
1189452880 X:41155902-41155924 TGTCAAAAGGACACAGGAGTTGG + Intronic
1189582587 X:42423014-42423036 GGTCTGATGGATAATGGTGTGGG - Intergenic
1190429187 X:50361955-50361977 GGACAAAAAGATAAAGGTGTTGG + Intergenic
1191163833 X:57366369-57366391 GGGCAAAAGAACAAAGCTGTGGG - Intronic
1192113688 X:68390912-68390934 TGTCAGAAGTCCAAAGGTGTTGG + Intronic
1194442810 X:93954010-93954032 GCTCAGAAGAAGAAAGATGTTGG + Intergenic
1195475466 X:105279981-105280003 GGTGAGAAGAACAAAGCTGGAGG + Intronic
1196480884 X:116146095-116146117 GGTAAAAATGACAAAAGTGTGGG + Intergenic
1198490385 X:137134164-137134186 GGTAAGAAGAACAAAGTTGGAGG + Intergenic
1201630617 Y:16068395-16068417 GGTCAGAAGCAAGAAGGAGTTGG - Intergenic