ID: 1008532347

View in Genome Browser
Species Human (GRCh38)
Location 6:52474926-52474948
Sequence AACCTGGATGGTGGTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 435}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008532347 Original CRISPR AACCTGGATGGTGGTTATAT GGG Intronic
901194071 1:7430475-7430497 AACATGGATGATGGTGATTTTGG + Intronic
902944799 1:19827370-19827392 AATCTAGACGGTGGATATATTGG + Intergenic
905548951 1:38820706-38820728 GACCTGGGTGGTGGTTACAAAGG + Intergenic
906454147 1:45979189-45979211 AACCTAGATGGTGTTTACACAGG + Intronic
908188417 1:61675344-61675366 GAACTGGATGGTGGTTAAATGGG + Intergenic
908218330 1:61977995-61978017 TACCTGGATGGTGGTTACATGGG - Intronic
908422751 1:63975408-63975430 AACCTGGATTTTTTTTATATGGG + Intronic
908518583 1:64918200-64918222 AACCTGAATGGTGGATACATAGG + Intronic
910247153 1:85151288-85151310 AATCTGGATGCTAGATATATGGG + Intergenic
911280396 1:95920076-95920098 AACTTAGATGGTGGTTACATGGG + Intergenic
911563928 1:99440105-99440127 GATCTGGGTGGTGGTTACATAGG + Intergenic
911707364 1:101029025-101029047 AACCTTGGAGGTGGCTATATGGG - Intergenic
912890808 1:113527925-113527947 AATCTAAGTGGTGGTTATATGGG - Intronic
912982894 1:114393907-114393929 CTCCTGGATGGTGATTTTATAGG - Exonic
915946686 1:160157779-160157801 AATCTGGATAAAGGTTATATAGG + Intronic
916478089 1:165188941-165188963 AAACTGGGTGTTGGTTATGTGGG - Intergenic
916900959 1:169222932-169222954 AGACTGTATTGTGGTTATATAGG - Intronic
918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG + Intergenic
918678625 1:187322771-187322793 AACCTGGATGATGGGTTCATAGG + Intergenic
918680973 1:187352677-187352699 AAACTGGATGAGGGGTATATGGG + Intergenic
918749250 1:188251676-188251698 AACCTGCATGTGGGATATATGGG - Intergenic
919333609 1:196204410-196204432 AACCTAGATGGTGGGTTGATAGG - Intergenic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
920079905 1:203365256-203365278 GACCTAGATGGTGTTTATGTGGG + Intergenic
920418685 1:205814930-205814952 GATCTGGATGGTGGTCATATGGG - Intergenic
920904797 1:210152633-210152655 GACCTGGATGGTAATTACATGGG - Intronic
921445971 1:215248066-215248088 AACCTGGATGATGGGTTGATAGG - Intergenic
921524130 1:216195836-216195858 CACCTGGATGCTGGTAAAATGGG + Intronic
921570557 1:216773347-216773369 AAACTGTATGTTGCTTATATTGG - Intronic
922472788 1:225887189-225887211 AAGCTGGATGTTTGTGATATAGG + Intronic
922494967 1:226049479-226049501 TACCAGGATGGTGGTATTATGGG - Intergenic
922859774 1:228806416-228806438 AAACTGGATGATGTATATATGGG - Intergenic
924520377 1:244801113-244801135 GACCTGGATGGTAGTTACAAGGG + Intergenic
924720522 1:246618827-246618849 AACCTGCATCGTGGTTATCTCGG - Intronic
924918858 1:248604567-248604589 AACCTGGATGATGGGTTAATGGG + Intergenic
1063742474 10:8838905-8838927 AACCTAGATGGTGGGTTGATAGG + Intergenic
1063760541 10:9070185-9070207 AACCTAGATGATGGGTTTATAGG - Intergenic
1063817260 10:9789873-9789895 AAACTGAATGGTGGTTGTATTGG - Intergenic
1063901674 10:10739499-10739521 AAGCTGGATGATGGGAATATGGG - Intergenic
1064289636 10:14021703-14021725 AATCTGGGTGGTGGTTACACAGG + Intronic
1064978245 10:21140853-21140875 AACCTAGATGGTGGGTTGATAGG + Intronic
1065626670 10:27636502-27636524 GATCTGGATTGTGGTTGTATAGG - Intergenic
1065905006 10:30242674-30242696 AACCTGGTTGGTATTTTTATTGG - Intergenic
1066799063 10:39163374-39163396 AACCTAGAAGGAGGTTATCTGGG + Intergenic
1068382451 10:56274453-56274475 AACCTGGATGATGGGTTGATAGG - Intergenic
1068427684 10:56888916-56888938 AACCTAGATGATGGTTTGATAGG - Intergenic
1069472043 10:68702216-68702238 GACCTGGATGGAGGTTACACAGG - Intergenic
1070717049 10:78730055-78730077 GACCTGGGTGGTGTTTACATAGG - Intergenic
1071017617 10:81016854-81016876 AAACTTGATGGCAGTTATATAGG + Intergenic
1071839559 10:89455080-89455102 AGACTGGATGGTAGCTATATAGG + Intronic
1072903312 10:99428952-99428974 AAGCTGGATGATGGGTACATGGG - Intronic
1073016042 10:100400143-100400165 AAACTGGGTGGAGGGTATATGGG - Intergenic
1074093042 10:110281148-110281170 AAACTGAATGGTGGGTATACAGG - Intronic
1074331667 10:112517978-112518000 AAACTGGGTGTGGGTTATATGGG + Intronic
1074671049 10:115791410-115791432 AACCTGGGTGGTGATTAGACAGG - Intronic
1074880926 10:117657905-117657927 AACATGGGTGGTGGGTATATGGG - Intergenic
1075425677 10:122340038-122340060 GATCTGGGTGCTGGTTATATGGG - Intergenic
1075518374 10:123128033-123128055 AATCTGGGTGCTGGTTTTATGGG + Intergenic
1075705854 10:124500102-124500124 AAGCTGGATGATGGATATAATGG - Intronic
1076425653 10:130365787-130365809 AACCTAGATGATGGGTTTATAGG - Intergenic
1077968764 11:7165436-7165458 AATGTGGATGATGGTTATATGGG + Intergenic
1079173135 11:18115146-18115168 TACCTTGATGGTGGTTCTACTGG - Intronic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1079996568 11:27300921-27300943 AACCTGAGTGATGGTTATACGGG - Intergenic
1080358515 11:31483221-31483243 TATCTGGGTGCTGGTTATATGGG + Intronic
1080786620 11:35480783-35480805 AACCTAGATGATGGGTAGATAGG - Intronic
1081902552 11:46641663-46641685 TATCTGGATTGTGGTTATATGGG + Intronic
1082101136 11:48174059-48174081 AATTTGGGTGCTGGTTATATGGG - Intergenic
1085226986 11:74930602-74930624 CCTCTGGATAGTGGTTATATGGG - Intronic
1085272003 11:75275511-75275533 AGCCTAGATGGTGGGTATATGGG - Intronic
1085358898 11:75867247-75867269 GATCTGGATGCTGGATATATGGG - Intronic
1085508973 11:77075774-77075796 GACCTGGGTGGTGGTTCCATGGG - Intronic
1085934898 11:81129189-81129211 AATCTAGATGGTGGTTATATGGG + Intergenic
1086093474 11:83027205-83027227 AACCTGAATGATGGGTACATGGG + Intronic
1086476791 11:87184998-87185020 AAACTGGATGATGGCTACATTGG - Intronic
1086806546 11:91251033-91251055 AACCTAGATGGTGGGTTGATGGG - Intergenic
1086858970 11:91901891-91901913 AACCTGAATGGTGGAAATTTGGG - Intergenic
1087086451 11:94223651-94223673 AATCTGGGGGGTGGTTACATAGG - Intergenic
1087237090 11:95732169-95732191 GAAATGGATGGTGGTTACATGGG - Intergenic
1087489021 11:98799754-98799776 AAGCTAGAGGGTGGTTACATGGG - Intergenic
1087674630 11:101145946-101145968 AATCTGGATGAAGGATATATGGG - Intergenic
1087904819 11:103683510-103683532 AATGTAGGTGGTGGTTATATGGG - Intergenic
1088348822 11:108861702-108861724 AAACTGGGTGGTAGTTACATGGG + Intronic
1088382826 11:109215790-109215812 AACCTAGATGATGGGTAGATAGG - Intergenic
1088617544 11:111645943-111645965 GACCTTCATGGTGGTTATGTAGG + Intronic
1089448666 11:118574462-118574484 AATCTAGTTGGTGGTTATATGGG - Intronic
1092320542 12:7469233-7469255 AACCTGGATGATGGGTTGATAGG + Intronic
1092944504 12:13440248-13440270 AAGCTGAATGGTGGGTACATAGG + Intergenic
1094112915 12:26880547-26880569 AACCTAGATGGTGGGTTGATAGG - Intergenic
1094223669 12:28022902-28022924 AACCTGGATGCAGATTATTTGGG + Intergenic
1094659459 12:32453078-32453100 AAGCTGGATGATGGGTAAATGGG - Intronic
1095215433 12:39542058-39542080 AACCTGGGTGGTGGTTAAACAGG + Intergenic
1097143118 12:56919790-56919812 AACCTGGATGATGGGTTAATAGG + Intergenic
1097294571 12:57948679-57948701 AGTCTGGGTGGTGGTTACATAGG - Intronic
1098874919 12:75857198-75857220 TATCTGGATGGTGGTAACATGGG - Intergenic
1099132849 12:78858153-78858175 AAGCTGGATTGTGGGTATACTGG + Intergenic
1099219762 12:79898994-79899016 AATCTAGATGGTGATTATATAGG - Intronic
1100472157 12:94903173-94903195 AACCGTGATGGTGGCTATTTCGG - Intronic
1100654924 12:96633344-96633366 AAACTGGATGAAGGGTATATGGG - Intronic
1100726371 12:97413270-97413292 GAACTGGGTGGTGGTTACATTGG + Intergenic
1100763680 12:97838748-97838770 CACCTGGATAGTAGTTACATAGG - Intergenic
1101112029 12:101495664-101495686 GGTCTGGATGTTGGTTATATGGG - Intergenic
1101627248 12:106457399-106457421 AGTTTGGATGGTGGTTTTATAGG - Intronic
1101803778 12:108045786-108045808 AACCTGGTTGGTGGTGTGATAGG - Intergenic
1102392519 12:112560792-112560814 GACCTGAATGCTGGTTACATTGG - Intergenic
1102410365 12:112712521-112712543 AAACTGGATGGTGAGTACATGGG - Intronic
1102535209 12:113576009-113576031 AACCTGGATGGTGGATCTTCAGG + Intergenic
1102897001 12:116606189-116606211 AACTTGGGTGATGGTTATACGGG - Intergenic
1103313899 12:120035736-120035758 AACCTGTGTGGTGGTTACAAAGG - Intronic
1104408406 12:128537895-128537917 AAGCTGGATGATGGGTACATGGG + Intronic
1105557963 13:21463740-21463762 TTCCTGGATGGTGGTTATAATGG - Intergenic
1105677369 13:22686999-22687021 AAGCTGGATATTGGGTATATGGG - Intergenic
1106295239 13:28407305-28407327 AATCTGGGTGGCGGGTATATGGG - Intronic
1106902483 13:34368495-34368517 AACCTGGATGATGGGTTGATGGG + Intergenic
1107219550 13:37966019-37966041 AACCTGGATGATGGGTTGATGGG - Intergenic
1107363273 13:39642578-39642600 AACCTGGTAGGTGGTGATACAGG + Intergenic
1107522753 13:41199715-41199737 GACCGGGCTGGTGGTTACATGGG + Intergenic
1107793019 13:44021613-44021635 AACATTGAGGTTGGTTATATTGG + Intergenic
1108202054 13:48053887-48053909 GATCTAGGTGGTGGTTATATAGG - Intronic
1108339139 13:49479302-49479324 ATTCTGGATGGTGGAAATATGGG + Intronic
1109692523 13:65911329-65911351 AACCTAGGTGGTGGGTTTATAGG + Intergenic
1110669776 13:78164020-78164042 AAACAGGATGCTGGGTATATGGG - Intergenic
1111495866 13:89048895-89048917 AACCTGTATGGTGGGTTGATAGG + Intergenic
1111681069 13:91442163-91442185 AACCTGGGTGGTAGTTACAAGGG - Intronic
1111830457 13:93322834-93322856 AACGTGCATGTTGGTTAAATAGG + Intronic
1112125734 13:96465693-96465715 AACCTGGGTGGTGCTTACATAGG + Intronic
1112418352 13:99224639-99224661 AATCTAGGTGGTGGGTATATGGG - Intronic
1115981758 14:39059579-39059601 AATCTAGGTGATGGTTATATAGG - Intronic
1116698983 14:48213857-48213879 AATCTGGATGGTGTTAATAGGGG + Intergenic
1117119894 14:52555377-52555399 AATCTGGGTGGTGGTAACATGGG - Intronic
1117152359 14:52902542-52902564 TATCTGGATGTTTGTTATATAGG - Intronic
1118611028 14:67540168-67540190 AAGCTGGCTGATGGGTATATGGG - Intronic
1119103121 14:71898596-71898618 AACCTGGATGATGGGTTGATGGG - Intergenic
1120570635 14:86112519-86112541 ATCATGGATGGTGGTTGTAAAGG - Intergenic
1121057093 14:90865512-90865534 GATCTGAATGATGGTTATATGGG + Exonic
1121088652 14:91166173-91166195 GATCTGGATGCTGGTTACATGGG + Intronic
1121183787 14:91949016-91949038 GATCTGGATGCTGGTTATGTAGG + Intergenic
1121238298 14:92409563-92409585 GACCTGGATGCTGGTGACATGGG - Intronic
1122455685 14:101848918-101848940 AGCCTGAATGGTGGTTATGTGGG - Intronic
1122737303 14:103850174-103850196 AACCTGGATGGTGGGTATGTTGG + Intergenic
1124449591 15:29774571-29774593 AACCTGAATGGTGGTTGTCTAGG + Intronic
1124961607 15:34401165-34401187 GACCAGGTTGGTGGTTACATGGG - Intronic
1124978233 15:34547387-34547409 GACCAGGTTGGTGGTTACATGGG - Intronic
1127280282 15:57484644-57484666 AACCTAGATGATGGTTTGATAGG - Intronic
1129222823 15:74142904-74142926 GATCTGGATGGTGGCTACATGGG + Intergenic
1130266454 15:82409067-82409089 GACCAGGTTGGTGGTTACATGGG + Intergenic
1130292428 15:82614322-82614344 GACCTGGGTAGTGGTTATGTGGG + Intronic
1130505570 15:84537815-84537837 GACCAGGTTGGTGGTTACATGGG - Intergenic
1130682505 15:86008944-86008966 AACCTGGATGATGGGTTGATAGG + Intergenic
1130761927 15:86830218-86830240 AACCTGGATGGTGATTGCATGGG - Intronic
1130852911 15:87815404-87815426 AAGCTGAATGGTGGGTATAAGGG + Intergenic
1131081528 15:89540413-89540435 AAGCTGGATGGTGAGTATATAGG + Intergenic
1131552280 15:93367429-93367451 AAACTGGATGGTGGATTTTTAGG + Intergenic
1132257951 15:100394080-100394102 GACCTGGGTGGTGGTTACATGGG - Intergenic
1134147384 16:11777107-11777129 GACCTGGATGGTGTGTACATGGG - Intronic
1134510476 16:14842606-14842628 CATCTGGATGGTGGATACATGGG - Intronic
1134698117 16:16241094-16241116 TATCTGGATGGTGGATACATGGG - Intronic
1134889682 16:17829100-17829122 AAACTAGATGGTTGGTATATAGG + Intergenic
1134973720 16:18553583-18553605 CATCTGGATGGTGGATACATGGG + Intronic
1135428846 16:22364501-22364523 AAGCTAGGTGGTGGATATATGGG + Intronic
1135604814 16:23814285-23814307 AAACTGGGTGGAGGGTATATGGG - Intergenic
1135912056 16:26570476-26570498 TGCCTGGATGCTGGTTATATAGG - Intergenic
1135986407 16:27187964-27187986 AAACTGGATGCAGGATATATGGG + Intergenic
1137362305 16:47829783-47829805 AACAAGCATGGGGGTTATATGGG + Intergenic
1138880396 16:61007364-61007386 AACCTGGGTGTAGTTTATATGGG - Intergenic
1138917413 16:61483150-61483172 AACGTGGAGGTTTGTTATATAGG - Intergenic
1139499842 16:67353739-67353761 AACCTTGAAGGTGGTTCTACAGG + Intronic
1140320321 16:73944657-73944679 AACCTAGATGGTGGGTTGATAGG + Intergenic
1140344040 16:74194985-74195007 AATCTAGGTGGTGGGTATATGGG + Intergenic
1140504254 16:75460566-75460588 GCCCTGGATGGTGATGATATTGG - Intronic
1140511769 16:75513677-75513699 ACCCTCGATGGTGATGATATTGG - Intergenic
1143356575 17:6333637-6333659 AAACTGGATGGTGGATACATAGG + Intergenic
1143566983 17:7728236-7728258 AATCTGGGTGGTGGTCATACAGG + Intronic
1143844220 17:9760583-9760605 GATCTGCATGGTGGTTACATGGG + Intergenic
1143943617 17:10569488-10569510 AATCTGGATGATGATTACATAGG - Intergenic
1144400615 17:14895488-14895510 TACGTGGATGGTGGTTAAAAGGG + Intergenic
1145756226 17:27392328-27392350 AATTTAGCTGGTGGTTATATTGG - Intergenic
1145805845 17:27728839-27728861 AACGTGCATGGTTGTTACATAGG + Intergenic
1145958984 17:28874926-28874948 GACCTGGATGGTGATTACATGGG - Intergenic
1145984055 17:29032497-29032519 AACCTGGCGGGTGGTTATGAAGG + Intronic
1146889755 17:36498884-36498906 ACCCTGCAGGGTGGTTATGTAGG - Intronic
1146933434 17:36794182-36794204 AAACTGGATGAAGGGTATATGGG + Intergenic
1149186508 17:54004308-54004330 AACCTGGAGGGTGGACAGATAGG + Intergenic
1149994920 17:61401264-61401286 AATCTGGAGGGTGTTTGTATTGG - Intronic
1150121116 17:62603702-62603724 AAGCTGGATGGTGCTTACTTAGG + Intronic
1150772896 17:68056563-68056585 TATCTGGATGGTGGTTACCTGGG - Intergenic
1150845346 17:68651518-68651540 GAACTTGATGGTTGTTATATGGG + Intergenic
1150897227 17:69226251-69226273 AATCTGGATGGTGGATGTATAGG + Intronic
1151003905 17:70411890-70411912 AACCTAGATGGTGGGTTGATAGG - Intergenic
1151186779 17:72370622-72370644 AACCTGGATGATGGGTTGATAGG + Intergenic
1151831005 17:76550602-76550624 AACTGGGATTGTGGTTACATGGG + Intronic
1155097963 18:22578090-22578112 AATCTGGATGGTGGTCACATAGG - Intergenic
1155307584 18:24493733-24493755 AACCTGGTTGGTGGTCATATAGG - Intergenic
1155500215 18:26480230-26480252 AAGCTGGTTGATGGTCATATGGG - Intronic
1155872882 18:31049108-31049130 AACCTGAATGATGGTAACATAGG - Intergenic
1155911967 18:31514341-31514363 AAACTGGATGTTAGCTATATGGG + Intronic
1156407019 18:36792348-36792370 AACCTGGATGATGGATACATGGG + Intronic
1156771196 18:40728650-40728672 AACCTAGATGGTGGGTTGATGGG - Intergenic
1157068698 18:44381083-44381105 AACCTAGATGATGGGTTTATAGG + Intergenic
1157131545 18:45012287-45012309 AACCTGTATTGTGGTTATCATGG + Intronic
1157634251 18:49134132-49134154 AATCTGGGTGGTAGGTATATGGG + Intronic
1158401149 18:57122471-57122493 TATCTGGGTGGTGGTTCTATAGG - Intergenic
1158482324 18:57832753-57832775 AAGCTGGCTTGTGGTGATATAGG - Intergenic
1158658343 18:59361132-59361154 AATCTGGATGCTGGTTGCATGGG - Intergenic
1159321420 18:66855623-66855645 AACCTGGATGATGGGTTGATAGG + Intergenic
1159802813 18:72921725-72921747 AACCTAGATGGTGGGTTGATAGG + Intergenic
1162537608 19:11272662-11272684 AACCTGGGTGGAGGTTATTAAGG - Intergenic
1164487370 19:28670304-28670326 GATCTGGGTGGTGGTTACATGGG + Intergenic
1165581258 19:36866299-36866321 AATCTTCATGGTGGTTATATGGG - Intronic
1166203836 19:41256059-41256081 AATCTGGGTGCTGGTTACATGGG + Intronic
1166928314 19:46285011-46285033 AGCCTGGAGGGTGGATGTATGGG - Intergenic
1167024676 19:46906575-46906597 GACTTGGGTAGTGGTTATATTGG - Intergenic
926171588 2:10556149-10556171 AACCTGGATGTGGGGTTTATGGG - Intergenic
926389488 2:12373681-12373703 ACAATGGATGGTGGTCATATAGG + Intergenic
927831706 2:26357093-26357115 GAGCTGGGTGGTGGTTACATGGG - Intronic
928181179 2:29070197-29070219 AACCTGGATGATGGGTTGATAGG - Intronic
928182306 2:29077464-29077486 GACCTAGGTGGTAGTTATATGGG + Intergenic
928319209 2:30269789-30269811 GACCTGGGTAGTGGTTTTATGGG - Intronic
928755625 2:34522122-34522144 AGCCTAGATGATAGTTATATGGG + Intergenic
928997075 2:37303899-37303921 GACCTGAGTGGTGGTTATGTGGG - Intronic
929319862 2:40529738-40529760 AACCTGCAGGTTTGTTATATAGG - Intronic
929463788 2:42126721-42126743 AAGCTGGATGGTGGGTACATGGG - Intergenic
929752356 2:44728913-44728935 AATCTGGGTGGTGGTTAGAAGGG + Intronic
929929531 2:46241779-46241801 AAGCTGGATGATGGGTATATGGG - Intergenic
930174297 2:48285894-48285916 AACCTGGGTGAAGGGTATATGGG - Intergenic
930267404 2:49215878-49215900 AACATGCATGTTTGTTATATAGG - Intergenic
930915170 2:56677927-56677949 AACCTGGATGATGGGTTGATAGG - Intergenic
931211071 2:60195755-60195777 AACCTAGATGATGGTTTGATCGG - Intergenic
931313379 2:61103639-61103661 AATGTGGATTGTGATTATATGGG + Intronic
931554608 2:63488583-63488605 GTCCTGGATGGTGATTTTATGGG + Intronic
931573463 2:63695713-63695735 GACCTGGGTGCTGGTTACATGGG - Intronic
931794215 2:65693811-65693833 AACCTGGGTGTTGTTTATTTTGG + Intergenic
932953392 2:76320629-76320651 GACCGGGATATTGGTTATATAGG - Intergenic
932984435 2:76708282-76708304 AACCTAGGTGAAGGTTATATGGG - Intergenic
933706598 2:85295556-85295578 AATCTGGATAAAGGTTATATGGG - Intronic
934306724 2:91830221-91830243 AACCTGGAGGTTTGTTATATAGG - Intergenic
934326532 2:92022521-92022543 AACCTGGAGGTTTGTTATATAGG + Intergenic
934876147 2:97922811-97922833 AATCTGGGTGGTGGTTACACAGG + Intronic
937424468 2:121787030-121787052 AATCTAGATGGTGGGTTTATAGG - Intergenic
937892118 2:126946828-126946850 AACCTGGGTGGTAGTTAACTTGG - Intergenic
937902390 2:127030693-127030715 AAACTGGATGCAGGTTATATGGG + Intergenic
941415006 2:165209045-165209067 AATCTGGGTAGTAGTTATATAGG + Intergenic
943071936 2:183151752-183151774 AACCTAGGTGGTAGTAATATGGG - Intronic
944377568 2:199064903-199064925 TATCTGGATGGTGGTTTCATAGG + Intergenic
944378535 2:199077635-199077657 AACCTGGAGGTTTGTTACATGGG - Intergenic
944587491 2:201185539-201185561 AACTTGGAGGGTGCTTATATTGG - Intronic
944804541 2:203268023-203268045 AACCTGGGTGAAGGATATATGGG - Intronic
944883086 2:204034989-204035011 AAACTACATGGTGGGTATATAGG - Intergenic
946597993 2:221327573-221327595 AACCTAGATGGTGGGTTGATGGG + Intergenic
1169501725 20:6167139-6167161 AACCTGGATGATGGGTTGATGGG - Intergenic
1169531832 20:6493356-6493378 AATCTGGATGATGGTTACATGGG - Intergenic
1170133435 20:13047817-13047839 AATCTGGATGGAGAGTATATAGG - Intronic
1170172785 20:13434155-13434177 AATCTGCATGCTGGTTATAGGGG + Intronic
1170231925 20:14058117-14058139 GACTTGGGTGGTGGTTACATGGG + Intronic
1170383176 20:15784741-15784763 AATCTAGATGGTGGATAAATGGG + Intronic
1170411631 20:16098239-16098261 AATCTGGGTGGTAGGTATATAGG - Intergenic
1171380276 20:24729394-24729416 CACATGGGTGGTGGTTATATGGG + Intergenic
1172454460 20:35057061-35057083 AAGCTGGGTGGTAGATATATGGG - Intronic
1172562425 20:35901031-35901053 GATCTGCATGGTGGTTATACAGG + Intronic
1172576884 20:36016419-36016441 AAACTGGATGTGGGGTATATGGG + Intronic
1173471741 20:43329242-43329264 AAGCTGGGTGGTGAGTATATGGG - Intergenic
1173707396 20:45122281-45122303 AATCTGGATGATGGGTATGTAGG - Intergenic
1175059863 20:56232120-56232142 TACCTGGATGGTGGTTTTGGAGG + Intergenic
1175520430 20:59599322-59599344 GACCTGGATGGTGGCAATGTCGG - Intronic
1176907862 21:14525710-14525732 TAGCTGGATGGTGGCTATATGGG + Intronic
1177695566 21:24566417-24566439 AACCTGTATTGTGGTTATTTTGG - Intergenic
1178912376 21:36685806-36685828 GATCTGGGTGGTGGTTATATGGG - Intergenic
1179326974 21:40356606-40356628 CACCTGGAAGGTGGATATAAAGG + Intronic
1183220088 22:36506751-36506773 AACCTGGAGGGTGGTTCAAAGGG - Intronic
1183413556 22:37669840-37669862 ATCCTGGATGGTGGCTGTGTAGG - Intergenic
1184605752 22:45573818-45573840 GACCTGGGTGGTGATTATAAAGG + Intronic
1184704351 22:46200218-46200240 AACCTGGGTGGTGTGTACATGGG + Intronic
949625216 3:5858123-5858145 GATCTGGGTGGTGGTTATATAGG + Intergenic
951083166 3:18476688-18476710 AACCTGAGTGATGGGTATATGGG + Intergenic
951196154 3:19826040-19826062 TACCTGGGTGGTGGTTATGCAGG - Intergenic
951207317 3:19938504-19938526 AATCTGGGTGGTAGATATATGGG + Intronic
952324377 3:32307723-32307745 CACCTGGAAGGTTGTTAAATCGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
953043662 3:39276962-39276984 AGCCTGGATGGTAGTAATGTGGG + Intronic
953481038 3:43252470-43252492 GACCTGGGTGGTGATTATACAGG - Intergenic
953603219 3:44387954-44387976 AATCTGGGTGGAGGTTACATGGG - Intronic
953940642 3:47092798-47092820 TACCTGGATGGTGGCTGTATGGG - Intronic
954991404 3:54843663-54843685 AACCTGGAGGATGGTTTTGTTGG + Intronic
956633764 3:71342797-71342819 AAACTGGATGAAGGGTATATGGG - Intronic
957002701 3:74905032-74905054 AACCTGGATGTTGATTACATGGG - Intergenic
959271624 3:104219174-104219196 AACCTGGATGATGGGTTGATGGG - Intergenic
959715096 3:109424286-109424308 AAACTGGATGTGGGGTATATAGG - Intergenic
959834111 3:110898264-110898286 AACCTAGATGATGGGTCTATAGG - Intergenic
960344646 3:116517947-116517969 AACCTGCAGGTTTGTTATATAGG + Intronic
960646520 3:119890632-119890654 GACCAGGGTAGTGGTTATATGGG + Intronic
962056592 3:131878533-131878555 AATCTGGATGCTGGTTTTACAGG + Intronic
962616566 3:137132315-137132337 AAGCTGGATGATGGCTACATCGG - Intergenic
962627665 3:137242681-137242703 AATCTGCATGGTGGGTGTATGGG + Intergenic
963450958 3:145481420-145481442 AACGTGGAAGTTTGTTATATAGG - Intergenic
964516223 3:157511296-157511318 AACCTAGATGGTGGGTTGATGGG + Intronic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
964696882 3:159518367-159518389 ACACTGGATGGTGGCTACATAGG + Intronic
965510034 3:169557826-169557848 AAGCTGCATGATGGTTATAATGG - Intronic
966356840 3:179089258-179089280 AACCTGTGTGATGGTTATATTGG - Intergenic
967335778 3:188343106-188343128 AACCTGGATGATGGGTGGATAGG - Intronic
971470815 4:27024601-27024623 AACTTGAATGGTATTTATATTGG + Intronic
972249889 4:37288227-37288249 AACGTGGAGGGTTGTTACATAGG - Intronic
972578478 4:40373789-40373811 GACCCGGATGGTGGTTACGTAGG + Intergenic
972676880 4:41268715-41268737 AAACTGGGTGGTGGGTTTATGGG - Intergenic
972699346 4:41479063-41479085 AAACTAGGTGGTGGGTATATGGG - Intronic
974524998 4:63039661-63039683 AAACTGAATGTGGGTTATATAGG - Intergenic
974531280 4:63110873-63110895 AACCTAGATGGTGGCTTGATAGG + Intergenic
974859707 4:67504881-67504903 AAGCTGGTTGATGGTTGTATTGG - Intronic
975195371 4:71518204-71518226 AGCCTGGAAGCTGGTTGTATGGG + Intronic
975674856 4:76816458-76816480 AACCTAGATGGTGGGTTGATAGG + Intergenic
975865514 4:78720011-78720033 AATCTGGATGATGGGTATACAGG + Intergenic
977131232 4:93240876-93240898 GACCTGGTTAGTGGTTAAATTGG - Intronic
977381139 4:96275054-96275076 AACGTAGATAGTGGTTAAATAGG + Intergenic
977984862 4:103371142-103371164 AACCTAGATGGTGGGTTGATAGG - Intergenic
978192350 4:105929047-105929069 AACCTAGATGATGGTTTGATAGG - Intronic
979148415 4:117276252-117276274 AACCTAGATGGTGGGTTGATAGG - Intergenic
979514653 4:121593828-121593850 GATCTGGATTGTAGTTATATGGG + Intergenic
979860685 4:125689277-125689299 AAACTGGTTGCAGGTTATATGGG + Intergenic
980237075 4:130122375-130122397 AAACTGCCTGGTAGTTATATGGG + Intergenic
980370602 4:131864533-131864555 AACCTGGATGATGGTTTGATAGG + Intergenic
981510329 4:145549547-145549569 CATCTGGATAATGGTTATATGGG + Intronic
981858800 4:149329206-149329228 AAACTGGATGAAGGGTATATGGG - Intergenic
982614330 4:157622032-157622054 GACCTGGGTGGTGGTTACAAAGG - Intergenic
983186244 4:164704381-164704403 GACATGGGTGGTGGATATATGGG + Intergenic
984818778 4:183861892-183861914 CACCTGGATGGTGGTTACGTGGG - Intronic
988347579 5:30058184-30058206 AAACTGAGTGGTGGGTATATGGG - Intergenic
988495838 5:31745272-31745294 TATCTGGATGGTGGTGTTATTGG - Intronic
989123211 5:38025616-38025638 CACCTGCACGGTGGTTTTATGGG + Intergenic
989731305 5:44653422-44653444 TACCAGGATGTTGTTTATATAGG - Intergenic
990259937 5:54011512-54011534 AAACTTGATAGTGATTATATAGG + Intronic
990659133 5:57993359-57993381 AACCTGGATGATGGGTTGATGGG - Intergenic
991002123 5:61793011-61793033 AACCTAGATGATGGGTTTATAGG - Intergenic
991065789 5:62423620-62423642 AAGCTGGATGATGGCTAGATGGG - Intronic
991083838 5:62630127-62630149 AATCTAGATGATGGGTATATTGG - Intergenic
992171994 5:74112000-74112022 GATCTGGGTGGTGGTTGTATGGG + Intergenic
992560002 5:77941932-77941954 AAACTGGATGATGGGTGTATGGG + Intergenic
992603162 5:78425875-78425897 AACCTGGATGATGGGTTGATAGG - Intronic
992917711 5:81476205-81476227 AGGCTGTATGGTGGTTATGTAGG - Intronic
993565856 5:89474180-89474202 AACTTGGATGGTGATTTGATTGG + Intergenic
993666210 5:90699657-90699679 AGCCTGGATGGTGGTGCTAGTGG + Intronic
994621930 5:102173963-102173985 AATCTTGATGGTGATTACATGGG + Intergenic
995358345 5:111265018-111265040 AAACTGGAAGGTGGTGATAGAGG - Intronic
995407103 5:111810645-111810667 AAGCTGTATTGTGGTTCTATAGG - Intronic
995460618 5:112399373-112399395 AACCTGGATGGTGATTACACAGG - Intronic
996322373 5:122233162-122233184 AACCTAGATGATGGGTAGATAGG - Intergenic
996959701 5:129232313-129232335 AATCTGGATGATGTGTATATAGG - Intergenic
998042496 5:138960961-138960983 GATCTGGGTGGTGGTTACATGGG + Intronic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
1000579584 5:163018760-163018782 AACCTAGATGGTGGGTTGATAGG + Intergenic
1001637243 5:173219777-173219799 GACCTGGCTGGCTGTTATATGGG - Intergenic
1001764053 5:174231165-174231187 AAATTGGATGATGGATATATAGG - Intronic
1002108151 5:176890497-176890519 AAACTGGATGGAGGTTAAACTGG + Intronic
1003261430 6:4519776-4519798 AACCTAGATGGTGGGTTGATAGG + Intergenic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1003694812 6:8393750-8393772 AAGCTGGATGGAGGATATATTGG - Intergenic
1004481930 6:16028919-16028941 GACCTCCATGGTGGTTGTATTGG + Intergenic
1004563845 6:16777235-16777257 AACCTGGGTGGTGGTCACAGAGG + Intergenic
1004923223 6:20395942-20395964 GACCTGGGTGGTGGTTACAAAGG + Intergenic
1005410519 6:25540437-25540459 TACCTAGATGGTGCTTATGTGGG + Intronic
1006112165 6:31754094-31754116 AAACTGCATGGTGGGTACATGGG - Intronic
1006588651 6:35137850-35137872 AAGCTGGATGATGGATAAATGGG + Intronic
1006791443 6:36703850-36703872 GACCTGGAGGGTGGTTACACAGG - Intronic
1007993146 6:46278300-46278322 AATCTGGATGAAGGGTATATAGG - Intronic
1008157902 6:48039519-48039541 AACCTTGGTGGTGTTTACATGGG + Intronic
1008178289 6:48294961-48294983 CACCTGGGTGGTGGTTATATGGG - Intergenic
1008423171 6:51326606-51326628 GACCTGAGTAGTGGTTATATTGG + Intergenic
1008532347 6:52474926-52474948 AACCTGGATGGTGGTTATATGGG + Intronic
1009950518 6:70390081-70390103 GACTTGGATGGTGGTTAAATGGG + Intergenic
1010025891 6:71216160-71216182 AATATGGGTGGTGGGTATATGGG + Intergenic
1010244659 6:73652000-73652022 AATCTGGGTGCTGGTTACATGGG + Intronic
1010613037 6:77979296-77979318 AACCTGTGTGGAGGGTATATAGG + Intergenic
1010712534 6:79191963-79191985 AAAATGTGTGGTGGTTATATTGG - Intergenic
1010792935 6:80085542-80085564 AACCTGGATGAAGAGTATATGGG + Intergenic
1011207869 6:84920403-84920425 AACCTAGGTGGTGGGTGTATGGG + Intergenic
1011926899 6:92656470-92656492 GGCCTGGATGGTGTTTACATGGG + Intergenic
1012111906 6:95245684-95245706 AAACAGGATTGTGGTTATATAGG + Intergenic
1013386032 6:109632091-109632113 GACCTGGTTGGTGGTTACATGGG + Intronic
1013394845 6:109725183-109725205 AACCTAGATGGTGGGTTGATAGG - Intronic
1013708875 6:112873662-112873684 AACCTGGATGATGGATTGATAGG + Intergenic
1013815668 6:114094585-114094607 AACTTGGATCGTTATTATATAGG - Intronic
1015784110 6:136903175-136903197 AACGTGGATAGTGGTTATACAGG - Intronic
1016238428 6:141896762-141896784 AACCTGGATGATGGGTTGATAGG + Intergenic
1016690404 6:146931064-146931086 AACCTGGATGTAGGCTCTATGGG - Intergenic
1016755730 6:147684043-147684065 GATCTGGATGGTGGTGACATGGG - Intronic
1017047406 6:150360167-150360189 AACCTAGATGGTGGGTTGATAGG - Intergenic
1020473698 7:8569606-8569628 AAGCTGGATGATGGGTCTATGGG + Intronic
1020764022 7:12298851-12298873 AACCTGTTGGGTGGTTATAAGGG + Intergenic
1020779883 7:12503538-12503560 AAACTGGATGATGGTTACATGGG + Intergenic
1020811983 7:12859052-12859074 GATCTGTATGGTGGTTACATAGG - Intergenic
1021839488 7:24711134-24711156 AAGCTGGATGGTGGGCACATGGG + Intronic
1021843836 7:24745157-24745179 CACCTGGATAGTGGTTAAACAGG - Intronic
1022331061 7:29379581-29379603 AACCTAGATGATGTGTATATGGG + Intronic
1022407890 7:30109233-30109255 AAACTGGGTGAAGGTTATATGGG - Intronic
1022982406 7:35616871-35616893 AAACTGGATAGTGGGTACATGGG - Intergenic
1023203817 7:37726555-37726577 AATCTGGGTGAAGGTTATATTGG - Intronic
1023335991 7:39171120-39171142 AACCTAGATGATGGGTTTATAGG - Intronic
1025156696 7:56613496-56613518 AACCTAGATGCTGGGTATAAAGG + Intergenic
1025760186 7:64382248-64382270 AACCTAGATGCTGGGTATAAAGG - Intergenic
1026659453 7:72287106-72287128 AATCTGGGTGGTGGGTACATGGG - Intronic
1026814818 7:73502409-73502431 AACCTGTATGGTGGGTACACAGG - Intronic
1026834927 7:73632316-73632338 TATCTGGATTCTGGTTATATGGG + Intergenic
1027341321 7:77211112-77211134 GACCTGGGTGGTGGTTACTTGGG - Intronic
1027635177 7:80662672-80662694 AACCTAGATGATGGTTTGATAGG - Intronic
1028172132 7:87610979-87611001 AAAATGGATGGTGGATATAGTGG - Intronic
1028216241 7:88137037-88137059 AACTTAGATGGTGGTTACCTTGG - Intronic
1028846668 7:95488788-95488810 CATCTGGATGCTGGTTACATAGG - Intronic
1029014640 7:97302951-97302973 TATCTGGATGCTGGTTACATGGG - Intergenic
1030630133 7:111886861-111886883 AAGTTGGATGAAGGTTATATGGG + Intronic
1030858921 7:114598833-114598855 AATCTGAATGGTGGTTCCATGGG - Intronic
1031785818 7:126030000-126030022 AAATTAGATAGTGGTTATATTGG - Intergenic
1033680464 7:143589491-143589513 TAACTGTATTGTGGTTATATGGG - Intergenic
1033704430 7:143872321-143872343 TAACTGTATTGTGGTTATATGGG + Intronic
1033705392 7:143881626-143881648 AAGCTGAATGGTAGGTATATGGG - Intronic
1033803430 7:144927426-144927448 GATCTGGATAGTGGTTACATGGG - Intergenic
1035959290 8:4119152-4119174 AACCTAGATGATGGTTTGATAGG + Intronic
1036922198 8:12868183-12868205 AAACAGGATGGTGGATACATAGG - Intergenic
1038330184 8:26601944-26601966 AACCTAGATGTTTGTTATTTAGG + Intronic
1038341360 8:26688630-26688652 AACCTAGATGATGGTTTGATAGG - Intergenic
1038606014 8:29005645-29005667 GATCTGGAGGGTGGTTATATGGG - Intronic
1038655067 8:29443297-29443319 TACCTGGGTGGTGGTTAAATGGG + Intergenic
1039129383 8:34245636-34245658 AACCTAGATGATGGTTTGATAGG - Intergenic
1039762988 8:40598293-40598315 AACCTAGATGGTGGATTGATAGG - Intronic
1039940790 8:42089006-42089028 AATATAGATGGTGGGTATATGGG + Intergenic
1039946774 8:42136481-42136503 AATCTGGGTGGTGGGTATATAGG - Intergenic
1040865841 8:52048203-52048225 AACCTGGATGATGGGTTGATGGG + Intergenic
1041603368 8:59750334-59750356 AATCTGGGTGCTGGTTATATGGG + Intergenic
1041860619 8:62508874-62508896 CATCTGGATGTTTGTTATATGGG - Intronic
1041996032 8:64059302-64059324 AACTGGTATGGTGGTTATATGGG + Intergenic
1043434573 8:80225930-80225952 AATCTGGGTGCTGGTTATGTGGG + Intronic
1045251924 8:100489779-100489801 TACCAGAATGGTGGATATATGGG + Intergenic
1045590591 8:103590572-103590594 CATCTAGATGGTGGGTATATGGG - Intronic
1047121819 8:121913222-121913244 AACCTAGATGATGGGTTTATGGG + Intergenic
1047132265 8:122034893-122034915 AACCTGGATGATGGGTTAATAGG - Intergenic
1047811362 8:128413216-128413238 ATCCTGGTTGGGGGTTATAAGGG - Intergenic
1048211621 8:132458803-132458825 AAACTGGCTGCAGGTTATATGGG - Intronic
1049835397 8:144732346-144732368 AACCTTGGTGGTGGGTGTATGGG + Intronic
1050524933 9:6537834-6537856 AATCTAGGTGGTGGGTATATGGG - Intronic
1051776730 9:20642475-20642497 CATCTGGATGGTGGTTAAATGGG + Intergenic
1052322980 9:27188263-27188285 AATCTGAGTGGTGGTTACATGGG + Intronic
1052804208 9:32998356-32998378 AATCTGGATGGTGGTCACATAGG + Intronic
1052846700 9:33342524-33342546 AAACTGGATGTTGTGTATATGGG - Intronic
1053635189 9:39991029-39991051 AACCTAGATGATGGTTTGATAGG + Intergenic
1053770743 9:41473282-41473304 AACCTAGATGATGGTTTGATAGG - Intergenic
1054208698 9:62259669-62259691 AACCTAGATGATGGTTTGATAGG - Intergenic
1054316107 9:63588471-63588493 AACCTAGATGATGGTTTGATAGG + Intergenic
1054549474 9:66385106-66385128 AACCTAGATGATGGTTTGATAGG - Intergenic
1055344574 9:75321786-75321808 AACCTGGATGATGGGTTGATAGG - Intergenic
1055506075 9:76950826-76950848 AACCAGGAGGGTGGTTAGTTGGG - Intergenic
1056878095 9:90357394-90357416 AACCTGTATGATAGTTCTATTGG + Intergenic
1057004541 9:91545890-91545912 AAACTGGGTGGTGGGTATGTGGG - Intergenic
1057552213 9:96060022-96060044 AACCTGGGTGAAGGTTATATTGG - Intergenic
1057838523 9:98466398-98466420 GACCTGGGTGGTAGTTACATGGG + Intronic
1058507984 9:105685995-105686017 AACCTGGATGGTGGGTTGATAGG + Intergenic
1059184061 9:112249277-112249299 AACCTGGGTGGTAGTCACATGGG + Intronic
1059569032 9:115414522-115414544 AAACTGAATGGTAGGTATATGGG + Intergenic
1059837063 9:118167237-118167259 AATCTGTGTGGTGGTTACATGGG - Intergenic
1060061338 9:120462987-120463009 AACCTAGGTGGTGAGTATATGGG + Intronic
1060708383 9:125830938-125830960 AAGCTGACTGGTGGTTATACAGG - Intronic
1061187889 9:129065678-129065700 AACCTGGGTGCTGGTTATACAGG - Intronic
1061612941 9:131760560-131760582 ATTCTGGATGGTGTTTATCTAGG - Intergenic
1061766598 9:132885559-132885581 AATCTGGGTGAGGGTTATATGGG - Intronic
1061976366 9:134069909-134069931 AACCAGGATGGTAGTTCTAAGGG - Intergenic
1186700916 X:12088897-12088919 CATCTGAATGTTGGTTATATGGG - Intergenic
1186767635 X:12787532-12787554 AATCTAGGTGGTGGGTATATCGG + Intergenic
1187297990 X:18021134-18021156 AACCTAGATGGTAGTTCAATGGG + Intergenic
1187483468 X:19679681-19679703 AAACTGGATGGTGTATACATGGG - Intronic
1187499793 X:19830301-19830323 GATCTGGGTGGTGGTTATAGAGG + Intronic
1187978733 X:24731873-24731895 AAACTGGATGATGGCTATACAGG + Intronic
1188335254 X:28923679-28923701 AACCTAGATGGCGGGTATATGGG + Intronic
1189235341 X:39482659-39482681 GATCTGGGTGGTGGTTACATGGG + Intergenic
1189427388 X:40913246-40913268 AAGCTGGATGGCGGGTATTTTGG - Intergenic
1189431002 X:40947275-40947297 GACCTGGATGGTAGTTATGAGGG + Intergenic
1189643368 X:43098866-43098888 AACCTAGATGATGGGTTTATAGG + Intergenic
1189738654 X:44096595-44096617 AATCTGGATATTGGTTATGTGGG + Intergenic
1189816656 X:44831241-44831263 AAACTGCATGTTGGGTATATGGG - Intergenic
1190049563 X:47139731-47139753 GACCTGAGTGCTGGTTATATGGG + Intergenic
1190148936 X:47924923-47924945 AATCTAGATGGATGTTATATAGG - Intronic
1190571595 X:51788033-51788055 AAGCTGGATGGTGAGTACATGGG - Intergenic
1190706910 X:53036650-53036672 AACCTGTTTAGTGGTTATACAGG + Intergenic
1190816195 X:53931986-53932008 AATCTGGGTGGTGGATATATGGG + Intergenic
1190995090 X:55599540-55599562 ATGCTGGATGGTAGTTACATGGG + Intergenic
1192506762 X:71690451-71690473 GATCTGGATGGCGGTTACATGGG + Intergenic
1192513176 X:71738589-71738611 GATCTGGATGGCGGTTACATGGG - Intergenic
1192513521 X:71742924-71742946 GATCTGGATGGCGGTTACATGGG + Intergenic
1192519935 X:71791095-71791117 GATCTGGATGGCGGTTACATGGG - Intergenic
1194021552 X:88697357-88697379 AACCTGCATGTTTGTTACATAGG - Intergenic
1194149323 X:90303915-90303937 AAATTGTATGGTGGCTATATAGG - Intergenic
1194416266 X:93616090-93616112 AACCTAGGTGGTGGCTATATTGG - Intergenic
1195034649 X:100961356-100961378 GACCTGGGTGGTGGTTACAAGGG + Intergenic
1195436728 X:104852933-104852955 AACCTGGATGATGGGTGCATTGG + Intronic
1195598803 X:106723172-106723194 AATCTAGATGGTGGGTGTATGGG - Intronic
1196115862 X:111999022-111999044 AACCTAGATGGTGGGTTGATAGG - Intronic
1196351688 X:114738700-114738722 AACCTGGATGATGGGTTGATGGG + Intronic
1196666301 X:118320452-118320474 AAGCTGGATGGTGGATACGTAGG + Intergenic
1196776419 X:119342124-119342146 AATCAGGATGTTGGTTACATTGG + Intergenic
1197861489 X:130975713-130975735 AAACAGGATGTTGGGTATATGGG + Intergenic
1198238707 X:134762368-134762390 GACCTGGGTGATGGTTACATGGG - Intronic
1198239367 X:134768115-134768137 AACCTGGGTGAAGGATATATAGG + Intergenic
1198331503 X:135627045-135627067 AACCTGAAAGGTGGGTATTTGGG + Intergenic
1198501316 X:137250774-137250796 AAACTGGATGGTGATTACAAAGG + Intergenic
1199209152 X:145186332-145186354 AACCTAGGTGGTGGAAATATAGG + Intergenic
1199492733 X:148418834-148418856 AGCCTGAATGGTGGTGATAATGG + Intergenic
1199801788 X:151259080-151259102 AATCTGGGTGATGGATATATGGG - Intergenic
1200388808 X:155921329-155921351 GATCTGGGTGGTGGTTACATGGG - Intronic
1200495698 Y:3880645-3880667 AAATTGTATGGTGGCTATATAGG - Intergenic
1200681051 Y:6211859-6211881 GACCTGGGTGGTGGGTATAATGG + Intergenic
1201535791 Y:15046812-15046834 AAACTGGGTGATGGGTATATGGG - Intergenic
1201537897 Y:15070989-15071011 AACCTAGATGGTGGGTTGATAGG - Intergenic