ID: 1008534375

View in Genome Browser
Species Human (GRCh38)
Location 6:52496081-52496103
Sequence TGTCAGGTTCAGGTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008534368_1008534375 13 Left 1008534368 6:52496045-52496067 CCTTATGCTACAGTCATAGCTGG No data
Right 1008534375 6:52496081-52496103 TGTCAGGTTCAGGTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008534375 Original CRISPR TGTCAGGTTCAGGTGGTGGA AGG Intergenic
No off target data available for this crispr