ID: 1008534528

View in Genome Browser
Species Human (GRCh38)
Location 6:52497794-52497816
Sequence AACACTCAAATCTGTACCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008534527_1008534528 9 Left 1008534527 6:52497762-52497784 CCGAAAAATGAGGTTTACAGTCT 0: 1
1: 0
2: 4
3: 11
4: 198
Right 1008534528 6:52497794-52497816 AACACTCAAATCTGTACCCAAGG 0: 1
1: 0
2: 2
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008534528 Original CRISPR AACACTCAAATCTGTACCCA AGG Exonic
903364737 1:22799105-22799127 AGAACTCAAATTTGTACCCAGGG - Intronic
904297662 1:29531974-29531996 ATCACACAAGTATGTACCCAGGG + Intergenic
905683710 1:39893553-39893575 AACATTCATGCCTGTACCCATGG + Intergenic
909291954 1:73894182-73894204 AACAATAAAATCTATAACCATGG + Intergenic
911611832 1:99966874-99966896 ACAATTCAAATCAGTACCCAAGG - Intergenic
913034422 1:114949237-114949259 AATACTAAAATCTCCACCCAAGG - Intronic
914334931 1:146705543-146705565 AACCCTCACATCTGTAGCTAGGG + Intergenic
915893602 1:159793800-159793822 AACTCTCAAACATGTGCCCAAGG + Intergenic
917098538 1:171423709-171423731 AACACTAAAATCTCCACCCAGGG - Intergenic
917536234 1:175876622-175876644 AACCCTCATATCTGTTACCAGGG + Intergenic
918978730 1:191526495-191526517 CACACTCAAATTTGATCCCAGGG + Intergenic
923684827 1:236146667-236146689 TACCCTCAGATGTGTACCCAAGG - Intronic
924322169 1:242861316-242861338 AACACCCAGGTCTGTCCCCAAGG - Intergenic
924903519 1:248427716-248427738 AATACTAAAATCTCCACCCAGGG + Intergenic
924924348 1:248664261-248664283 AATACTAAAATCTCCACCCAGGG - Intergenic
1063500941 10:6553676-6553698 AACTCTCAAATATGTTCCCAAGG - Intronic
1063521887 10:6748667-6748689 AACCTCCAAATCTGTAGCCAAGG - Intergenic
1064996740 10:21302817-21302839 GAGAATCAAATCTTTACCCAAGG + Intergenic
1067757516 10:49016097-49016119 AATACTGATATCAGTACCCAGGG - Exonic
1068584003 10:58776333-58776355 AGCACTGTAATCTGTAGCCAGGG - Intronic
1069841702 10:71343873-71343895 AACACTGAGTTCTGTCCCCATGG + Intronic
1072306524 10:94113047-94113069 AACAGGCAAATCTGTAGCGATGG + Intronic
1072448855 10:95522836-95522858 AGCACTAAAATCTGGACCCTAGG + Intronic
1073521243 10:104131882-104131904 TACACTCAGATATGTCCCCAGGG + Intronic
1073890417 10:108095071-108095093 AACACTGAACTCTGCCCCCAAGG - Intergenic
1080016884 11:27517018-27517040 AAATCTCAACTCTGTCCCCAAGG + Intergenic
1080690086 11:34549155-34549177 AGCTCTCAAATCTGGACCCAGGG + Intergenic
1082005135 11:47415025-47415047 AACACCCAACTGGGTACCCAAGG - Exonic
1083082927 11:60112380-60112402 AATACTAAAATCCCTACCCAGGG - Intergenic
1085660408 11:78360067-78360089 ATCACTCCAATCTCTGCCCATGG - Intronic
1085768638 11:79306055-79306077 ACCACTCAAGTCTGGAGCCACGG + Intronic
1086880596 11:92149113-92149135 AAAACTGAATTCTGTATCCAAGG - Intergenic
1093937806 12:25019710-25019732 CACCCTCAAACCTGGACCCATGG - Intergenic
1095585213 12:43842342-43842364 CACTCTGAAATCTGTCCCCAGGG - Intronic
1098616377 12:72529667-72529689 AACACTCACATATGAACACAAGG - Intronic
1100135977 12:91553834-91553856 AAAACTAAAACCTGAACCCATGG - Intergenic
1100401842 12:94237841-94237863 AACGCTCAAACCTGTGCCAAAGG + Intronic
1103147766 12:118610390-118610412 AAACCTCAAATCTGTATCCAAGG + Intergenic
1104955327 12:132462071-132462093 CACACTCACACCTGGACCCAAGG + Intergenic
1105903108 13:24774912-24774934 AATACTCAAATAAGTACACATGG - Intronic
1106642901 13:31604573-31604595 AATCCCCAAATCAGTACCCATGG - Intergenic
1108232064 13:48355862-48355884 AAAAATCAAATCTGAACTCATGG + Intronic
1108326114 13:49333450-49333472 AACAGTCTCATCTATACCCATGG + Intronic
1112052513 13:95656933-95656955 AATACTAAAATCTCTGCCCAAGG + Intergenic
1112953647 13:105033555-105033577 AACACTCAAACATATAACCAGGG - Intergenic
1113336789 13:109384215-109384237 AATACTCCAAGCTGTATCCAAGG - Intergenic
1116801654 14:49450331-49450353 AAAATTCAAATTTCTACCCAAGG - Intergenic
1118720407 14:68589953-68589975 TGCATTCAGATCTGTACCCATGG + Intronic
1118842330 14:69522526-69522548 AACACTCAAACCTGGAGCCTTGG - Intronic
1119132582 14:72188122-72188144 AACACTCATATTTCTTCCCAAGG - Intronic
1120856368 14:89216311-89216333 AAAACCCAAATGTTTACCCAAGG + Intronic
1121311621 14:92938525-92938547 AACATTCCTCTCTGTACCCAGGG - Exonic
1124900360 15:33816973-33816995 CACACTCATATCTGCTCCCAGGG - Intronic
1127697733 15:61468375-61468397 AACAATCAAATCAGAACCCCTGG + Intergenic
1129651510 15:77494086-77494108 AACAGTGAAATCTTTAGCCAGGG - Intergenic
1130699945 15:86167752-86167774 ATCACACAAATGTGTAGCCATGG + Intronic
1131322414 15:91407198-91407220 AGCACTCAACTCCGTGCCCATGG - Intergenic
1132273813 15:100548988-100549010 AAGGCTCAACTCTGTAGCCAGGG - Intergenic
1139998692 16:71005693-71005715 AACCCTCACATCTGTAGCTAGGG - Intronic
1140343958 16:74194215-74194237 AACCCCCAAATCTGTACTTATGG - Intergenic
1140343993 16:74194528-74194550 AACCCCCAAATCAGTACTCATGG - Intergenic
1140443714 16:75006836-75006858 CACACTCAAGACTGAACCCATGG - Intronic
1141208743 16:81956813-81956835 AACACTGAACTCTTTAACCAGGG - Exonic
1143353223 17:6305122-6305144 AACACTTAAATCAGTAGACATGG - Intergenic
1145917303 17:28582443-28582465 AAACCTCAAGACTGTACCCAAGG + Intronic
1146932475 17:36787252-36787274 AACACTGAAAGATGTGCCCAAGG + Intergenic
1147959100 17:44155274-44155296 AACACTCCAATCTGGAGTCAAGG - Exonic
1149285434 17:55158858-55158880 AATCCTCCAATCTGTGCCCATGG - Intronic
1150493280 17:65588916-65588938 AACATTCAAATCTGTACCCTAGG + Intronic
1151959517 17:77398333-77398355 AACATTCAACTCTGTTCCCGGGG + Intronic
1153627744 18:7038011-7038033 AAATCTAAAATCTATACCCATGG - Intronic
1154064302 18:11092493-11092515 TAGACTAAAATCTGTAACCACGG - Intronic
1156404421 18:36770734-36770756 AACATTCTAATGTGTATCCAGGG - Intronic
1160734602 19:656834-656856 CACAGTCAAATCTGAACCCCTGG + Intronic
1163919271 19:20273587-20273609 AAAACACAAATCTGAGCCCAGGG - Intergenic
1168539990 19:57202213-57202235 AAAAAGCAAATTTGTACCCATGG + Intronic
926333805 2:11848556-11848578 AATTCTCAAAACTGTCCCCAGGG + Intergenic
933462853 2:82611860-82611882 CACACTCAAGCCTGGACCCACGG + Intergenic
935082977 2:99816832-99816854 AACACAAAAAACTCTACCCATGG - Intronic
935653981 2:105405999-105406021 CACACACAAATCTGTACCATGGG - Intronic
936483159 2:112904401-112904423 AAAGCTCAAATTTGCACCCAAGG - Intergenic
936820030 2:116509271-116509293 AAAATTCATATCTGTACCAAGGG - Intergenic
937936918 2:127253313-127253335 CACACTGAAATCTCTACACAGGG - Intergenic
938034614 2:128026659-128026681 AACACTCAAATCTCACACCAAGG + Intronic
939776186 2:146390948-146390970 CACCCTCAAGCCTGTACCCATGG - Intergenic
941389880 2:164898549-164898571 AATACTCAAGACTGCACCCATGG - Exonic
942326290 2:174779483-174779505 CACACTCAGATGTGTTCCCAGGG + Intergenic
944345656 2:198662305-198662327 AAAACTCAAAACTGGATCCAAGG - Intergenic
947312710 2:228821662-228821684 AATACTAAAATCTCTGCCCAAGG + Intergenic
948257110 2:236576503-236576525 AACTATGAAATGTGTACCCAGGG - Intronic
948367466 2:237466591-237466613 AACACTGACATTTGTAACCAGGG + Intergenic
1171375790 20:24693496-24693518 AACACTGAACTTTGTTCCCATGG + Intergenic
1172232308 20:33345110-33345132 AAATCTTAAATCTCTACCCATGG + Intergenic
1172943962 20:38674043-38674065 AACATTCAAAGCTGGACCCAGGG + Intergenic
1176261889 20:64186187-64186209 AACCCCCACATCTGTCCCCATGG - Intronic
1177012794 21:15749199-15749221 GGCACTCAAATATGTACACAAGG - Intronic
1177709282 21:24750908-24750930 AACATTAAAATCTGTCCCTAAGG + Intergenic
1178087102 21:29122802-29122824 CACCCTCAAACCTGGACCCATGG - Intronic
1179109205 21:38431727-38431749 AACTCTCAAAGCTTAACCCAGGG - Intronic
1183760948 22:39817272-39817294 AACACTCACATATGTGCACAAGG + Intronic
1184553349 22:45217726-45217748 AACCCTAAAATCAGTACTCATGG - Intronic
1185204567 22:49530265-49530287 ACCAGTCAAAGCTGTAGCCATGG + Intronic
952623667 3:35377217-35377239 AACAGACAAATCTGCACACAAGG + Intergenic
953820579 3:46204464-46204486 AACACTCCATTTTGTCCCCAGGG - Intronic
953856304 3:46501861-46501883 AACCCCCAAATCAGTACTCATGG - Intergenic
954736644 3:52713003-52713025 CACCCTCAGATCTGTGCCCATGG - Intronic
955286112 3:57643516-57643538 TACAGTCTTATCTGTACCCATGG - Intronic
958116264 3:89222010-89222032 AACACGCAAATCTTTTCACAGGG + Intronic
962614058 3:137106698-137106720 AACACTGAAAGCTGTTACCATGG + Intergenic
965191504 3:165535910-165535932 AACACACAAATATATAACCATGG - Intergenic
966252873 3:177886299-177886321 CACACTCACATATGTACACACGG + Intergenic
966595796 3:181723867-181723889 AAGCCTCCATTCTGTACCCATGG + Intergenic
971923734 4:32978616-32978638 AACACTAAAATCTGAAATCATGG - Intergenic
972584248 4:40421899-40421921 AGGACTCAAATCTATACTCAAGG - Intergenic
972656628 4:41069627-41069649 AACACTCATCTCTGTATCCTCGG + Intronic
975984243 4:80188575-80188597 AACACTCAGGTCTGAACCCGGGG - Intronic
986779413 5:11050547-11050569 AACTCTCACATATGTCCCCATGG + Intronic
987437446 5:17913106-17913128 AACTCTCAAATCTGTATCTCTGG - Intergenic
991139958 5:63228598-63228620 AACTCTCAGATCTTTAACCATGG - Intergenic
997113306 5:131098988-131099010 AACACTGAAAACTGAACCCTTGG + Intergenic
998122863 5:139593366-139593388 AACACTCAAGTCCTTACCCTTGG + Intronic
999527765 5:152426370-152426392 AACACTCAAAGCTGAACTGAGGG - Intronic
1000190439 5:158905050-158905072 CACAGGCAAATCTGCACCCAGGG + Intronic
1000658950 5:163915704-163915726 CACCCTCAGATCTGTGCCCACGG - Intergenic
1001562839 5:172680757-172680779 AACATTCAAAACTGAACACATGG - Intronic
1001935143 5:175698369-175698391 AACGCTCAAATCTGAACCCAGGG - Intergenic
1002980274 6:2128992-2129014 AACACTGAAACCTGGCCCCATGG - Intronic
1003332980 6:5145008-5145030 ACCTCTCAAATATGTTCCCAGGG - Intronic
1003728395 6:8792234-8792256 AATACTCAAATCTGTATCTTCGG - Intergenic
1008534528 6:52497794-52497816 AACACTCAAATCTGTACCCAAGG + Exonic
1008809525 6:55478700-55478722 AACACTCAAATCTTTAGTGAAGG + Intronic
1012677958 6:102140740-102140762 AACATTCAAATTTCTACCTAAGG - Intergenic
1014295285 6:119610095-119610117 AACCCTAAATTCTGTACCCACGG - Intergenic
1014569506 6:122991636-122991658 AACCCTCAGATCTGTACTAAAGG + Intergenic
1019828891 7:3306097-3306119 AGCAATCAGATCTGTACCAAAGG + Intronic
1021069090 7:16214822-16214844 AGAACTCAGATCTGTATCCATGG - Intronic
1022232791 7:28430137-28430159 AATACACAAATATGTATCCATGG - Intronic
1025109930 7:56205716-56205738 AACATTCAAATCTGCCACCAAGG - Intergenic
1031444882 7:121840301-121840323 AACACTCAAGTCTGTACAGGAGG - Intergenic
1031528287 7:122848043-122848065 AACACTCAACTCTTTGCCTATGG + Intronic
1035781861 8:2233902-2233924 ATCAGTCAAATCTGTTGCCAGGG + Intergenic
1035810258 8:2485504-2485526 AGCACTCAAATCTGTTGCCAGGG - Intergenic
1036736599 8:11323904-11323926 AACACTCAAATCTGTTTCTGAGG - Exonic
1038523820 8:28256485-28256507 TACACTTAAATCAGTACACAGGG - Intergenic
1038762623 8:30398486-30398508 AACACTCTAACCTCTACCTATGG - Intronic
1041930959 8:63285806-63285828 AACACTCAAAGGTTGACCCAAGG - Intergenic
1042840217 8:73116225-73116247 AACAATCAAACCTGTACCCTTGG - Intronic
1042912573 8:73843119-73843141 AACAGTCAAATCTGTAGAGATGG + Intronic
1043099529 8:76023650-76023672 AACACTCACATTTGCTCCCATGG - Intergenic
1045125038 8:99079582-99079604 AACTCTAAAATCTATACACAAGG - Intronic
1045601194 8:103718825-103718847 TACACACAAAAATGTACCCAGGG - Intronic
1046261975 8:111780484-111780506 AGCATTCAGATTTGTACCCATGG + Intergenic
1048263221 8:132963170-132963192 ATCACTCTATTCTGTATCCATGG + Intronic
1048596204 8:135868931-135868953 AACACTCTTATCTTTACCCCTGG - Intergenic
1050782189 9:9351172-9351194 AAAACTCAAATCTGTACATTTGG - Intronic
1058818806 9:108710240-108710262 CACACTCAAGCCTGTAGCCATGG + Intergenic
1059017837 9:110540896-110540918 ACCTCTCAAATCTGTAGCCAAGG - Intronic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1189015205 X:37089725-37089747 AACACTCTAACCTCTACCTATGG - Intergenic
1190862974 X:54360984-54361006 AACAGTCACAACTCTACCCATGG - Intergenic
1193352557 X:80479621-80479643 AACAGTCAAATCAATTCCCAGGG - Intergenic
1196041226 X:111206334-111206356 GGCACTCAAAGCAGTACCCAAGG - Intronic
1198151797 X:133918054-133918076 AACATTCAAAATTGTATCCAGGG + Intronic
1202301857 Y:23424420-23424442 ACCACTAACATCTGTACCCTGGG + Intergenic
1202568954 Y:26246178-26246200 ACCACTAACATCTGTACCCTGGG - Intergenic