ID: 1008536137

View in Genome Browser
Species Human (GRCh38)
Location 6:52507745-52507767
Sequence CTGTGGGACTCGTGGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008536137_1008536147 9 Left 1008536137 6:52507745-52507767 CCCATGTCCCACGAGTCCCACAG 0: 1
1: 0
2: 2
3: 6
4: 166
Right 1008536147 6:52507777-52507799 ACCAGGCTGCTGAAATTCAAGGG 0: 1
1: 0
2: 1
3: 30
4: 255
1008536137_1008536149 17 Left 1008536137 6:52507745-52507767 CCCATGTCCCACGAGTCCCACAG 0: 1
1: 0
2: 2
3: 6
4: 166
Right 1008536149 6:52507785-52507807 GCTGAAATTCAAGGGCATTCAGG 0: 1
1: 0
2: 0
3: 13
4: 128
1008536137_1008536141 -8 Left 1008536137 6:52507745-52507767 CCCATGTCCCACGAGTCCCACAG 0: 1
1: 0
2: 2
3: 6
4: 166
Right 1008536141 6:52507760-52507782 TCCCACAGTCCCACTGCACCAGG 0: 1
1: 0
2: 2
3: 50
4: 281
1008536137_1008536146 8 Left 1008536137 6:52507745-52507767 CCCATGTCCCACGAGTCCCACAG 0: 1
1: 0
2: 2
3: 6
4: 166
Right 1008536146 6:52507776-52507798 CACCAGGCTGCTGAAATTCAAGG 0: 1
1: 0
2: 2
3: 23
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008536137 Original CRISPR CTGTGGGACTCGTGGGACAT GGG (reversed) Intronic
901409114 1:9070612-9070634 CTGTGGGACTTGTGAGACTTTGG - Intronic
902965204 1:19996037-19996059 CTTTGGGACTTGTTGGACAGTGG + Intergenic
909403205 1:75257860-75257882 CAGTGGGACTAGTTGGACAGTGG + Intronic
910360902 1:86412916-86412938 TTGTGGGCCTCCTGGGATATTGG - Intergenic
913215088 1:116613588-116613610 CTGAGGGATGTGTGGGACATAGG - Intronic
914209081 1:145561867-145561889 CACTGGGACTCGTTGGACAGTGG - Intergenic
914268000 1:146054233-146054255 CACTGGGACTCGTTGGACAGTGG - Intergenic
917308843 1:173656111-173656133 CATTGGGACTGGTTGGACATTGG - Intronic
920849905 1:209621708-209621730 CCGGGAGACTCGTGTGACATTGG - Intronic
922121244 1:222671260-222671282 CTGTTGGACTTTGGGGACATAGG - Intronic
923067070 1:230527602-230527624 CATTGGGACTCGTTGGACAGTGG - Intergenic
924948541 1:248862739-248862761 CTGTGGGTCTCGTGGAATTTGGG - Intergenic
1062906010 10:1180185-1180207 CTGTGGGAATCCTGGGACCTGGG + Exonic
1062906054 10:1180314-1180336 CTGTGGGAATCCTGGGACCCGGG + Exonic
1062906084 10:1180400-1180422 CTGTGGGAATCCTGGGACCCGGG + Exonic
1071838527 10:89444741-89444763 CACTGGGACTCGTTGGACAGTGG + Intronic
1072083319 10:92054800-92054822 CTGTGGGATTCTTGGGTCAAAGG - Intronic
1072627958 10:97126279-97126301 ACATGGGACACGTGGGACATGGG + Intronic
1075032838 10:119037833-119037855 CTGTGTGACCCGTTGGGCATTGG - Intronic
1075177736 10:120181551-120181573 CTGTGTGACACTGGGGACATGGG - Intergenic
1075934020 10:126324302-126324324 CTGAGGGAGTCAGGGGACATGGG + Intronic
1076303011 10:129442025-129442047 CTGTGGGATCCTTGGGCCATAGG - Intergenic
1076611218 10:131727039-131727061 CTGTGGGACTCAGGGAAGATGGG - Intergenic
1078647067 11:13150548-13150570 TTTTGTGACTCGAGGGACATGGG - Intergenic
1079088153 11:17461826-17461848 CTGTGGGGCACATGGGCCATGGG + Intronic
1081128078 11:39343467-39343489 TTGTGGGCCTCCTGGGATATTGG - Intergenic
1083682228 11:64356970-64356992 CTGTGGGCCTCCTGGGACTCTGG + Intronic
1083997182 11:66278337-66278359 CCGTGGGGCTCGGGGGACGTGGG - Exonic
1084515766 11:69637353-69637375 CTGCGGGACTCGCGGGGCCTAGG - Intergenic
1087891857 11:103544733-103544755 TTGTGGGCCTCTTGGGATATCGG - Intergenic
1088338709 11:108738871-108738893 CTGTGGGACTTGAGGGGCAGGGG - Intronic
1089073760 11:115720706-115720728 CTGTTGGACACGTAGGACTTTGG + Intergenic
1089354419 11:117840506-117840528 CTGTGGGATGCATGGGACAGAGG + Intronic
1090390892 11:126386522-126386544 CTGTGGCTCTCCTGGGACACAGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091297399 11:134483447-134483469 CAGTGGGACTCGAGGGGCACTGG + Intergenic
1094215347 12:27935052-27935074 GTGTGGGACAGGTGGGATATAGG + Intergenic
1094333073 12:29317718-29317740 CTGTGGCACTCGTGGGGCTAAGG + Intronic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1096497927 12:52049461-52049483 CTGTGGGACCAGTGAGGCATGGG + Intronic
1097534384 12:60847979-60848001 CTGTGGGACTTCAGGGACAAGGG + Intergenic
1103985898 12:124767308-124767330 CTGTGGGGTTCGTGGTCCATGGG - Intergenic
1105837459 13:24223768-24223790 CTGTGGTACCCGTGCGTCATGGG - Exonic
1111612034 13:90617132-90617154 TTGTGGGTCTCCTGGGATATTGG - Intergenic
1114209474 14:20602867-20602889 TTGTGGGCCTCGTGGGGTATTGG + Intronic
1115025012 14:28733961-28733983 CTCTGAGACTCATGAGACATGGG - Intergenic
1116482740 14:45411517-45411539 CACTGGGACTGGTTGGACATTGG + Intergenic
1117003287 14:51393551-51393573 CTGTGGGAATGCTGGGCCATGGG - Intergenic
1120527332 14:85592332-85592354 TTGTGGGACACGTGGTAAATGGG + Intronic
1121644402 14:95507932-95507954 CTGTGGGACCAGTGTCACATGGG - Intergenic
1123931870 15:25175834-25175856 CTGTTGGACTCGTGGGCTTTGGG + Intergenic
1125219813 15:37320071-37320093 CATTGGGACTCGTTGGACAGAGG + Intergenic
1129508047 15:76099406-76099428 CACTGGGACTCGTTGGACAGTGG - Intronic
1130703722 15:86211847-86211869 CATTGGGACTGGTGGGACAGTGG - Intronic
1132370766 15:101296226-101296248 GAGTGGGACTGCTGGGACATAGG + Intergenic
1132469509 16:94148-94170 CTGTGGGAGTCGGGGCACATGGG - Intronic
1133042368 16:3067483-3067505 CTGTGGGACACCTGGGACCCTGG + Intronic
1141206584 16:81937853-81937875 CTCTGGGACTCGGGTGGCATCGG - Exonic
1151459186 17:74244524-74244546 CCGCGGGAGTCCTGGGACATTGG - Intronic
1151999291 17:77635320-77635342 CTCTGGTACTGGTGGGACATGGG - Intergenic
1152450976 17:80379855-80379877 CTGTGTGACTGCTGGGACTTTGG - Intronic
1152633867 17:81422652-81422674 CTGAGGGCCCCGTGGGACACCGG + Intronic
1156742565 18:40350077-40350099 CTGTGGGCCCAGTGGGCCATAGG - Intergenic
1158563773 18:58536935-58536957 GTGTGGGACTCCTGGCACACTGG + Exonic
1158640957 18:59203094-59203116 GTGTGGGACCCTTGGGCCATGGG - Intergenic
1160081064 18:75727564-75727586 CCATGGCACTCGTGGGCCATTGG - Intergenic
1163435369 19:17292289-17292311 CTGTGGGGCTCGTGGGTCCCAGG + Exonic
1165280030 19:34788206-34788228 CTTTGGGATCCATGGGACATTGG - Intergenic
1165395421 19:35561094-35561116 GTGTGGGACATGAGGGACATGGG - Intronic
1167949504 19:53014980-53015002 CTGTGGGACTTTTGGGACCACGG + Exonic
1167954073 19:53050141-53050163 CTGTGGGACTTTTGGGACCACGG + Exonic
927027892 2:19089372-19089394 CACTGGGACTGGTGGGACAGTGG + Intergenic
927517742 2:23681999-23682021 CTGTGGGACACCTGGGGGATGGG - Intronic
928411838 2:31060394-31060416 CTGTGGCAGGAGTGGGACATTGG - Intronic
931860850 2:66352891-66352913 CACTGGGACTCGTCGGACAGTGG - Intergenic
932128537 2:69167191-69167213 ATGTGGAACCTGTGGGACATGGG + Intronic
933089573 2:78104152-78104174 CTCTGGGACTTCTGGGTCATGGG + Intergenic
933090282 2:78109353-78109375 TTGTGGGCCTCCTGGGATATTGG - Intergenic
933355550 2:81205893-81205915 CTTTGGGACTGGTTGGACAGTGG + Intergenic
934074700 2:88418074-88418096 CTGTGGTACTTGTGGGGCAAGGG - Intergenic
935216387 2:100978162-100978184 CTTTGGGACTGGTGGGGCAAGGG - Intronic
938721260 2:134069181-134069203 GTGTGGGACTGGTTGGAAATTGG - Intergenic
939933152 2:148257388-148257410 TTGTGGGCCTCCTGGGATATTGG - Intronic
942409925 2:175698222-175698244 CTGTGTGACTCCTAGGTCATGGG + Intergenic
944391989 2:199227498-199227520 CTGTGGGCCTTCTGGGATATTGG - Intergenic
948035123 2:234852273-234852295 CTTTGGGAGCCATGGGACATGGG - Intergenic
1171175398 20:23048297-23048319 CTGTGCGGCTCGTGGGGAATGGG + Exonic
1175734200 20:61373951-61373973 GTGTGGAACTCGTGGGGCAGTGG + Intronic
1176064239 20:63186625-63186647 CTCTGGCACTCCTGGGGCATGGG + Intergenic
1178822007 21:35983866-35983888 CTGTGGGACTTGAGGGGCAAGGG + Intronic
1179547706 21:42123902-42123924 CTGTGGGGCTCCCGGGACAGAGG + Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179840494 21:44069704-44069726 CTGTGGCACCCGTGAGTCATTGG + Intronic
1180821688 22:18833368-18833390 CTGTGGGATTCATGTGTCATAGG - Intergenic
1181207908 22:21267833-21267855 CTGTGGGATTCATGTGTCATAGG - Intergenic
1181984451 22:26789784-26789806 CTGTGGGCCTCGGGTGACATGGG + Intergenic
1184551004 22:45204125-45204147 CTGTGGGGCTCGGAGGGCATGGG - Intronic
1203219012 22_KI270731v1_random:27583-27605 CTGTGGGATTCATGTGTCATAGG + Intergenic
1203271813 22_KI270734v1_random:59244-59266 CTGTGGGATTCATGTGTCATAGG - Intergenic
949846028 3:8371923-8371945 CTTTGGGACTGGTTGGACAGCGG + Intergenic
950741811 3:15058161-15058183 CTGTGGGCCTGGTGGCACAGTGG - Intronic
951012110 3:17693219-17693241 CATTGGGACTGGTTGGACATTGG + Intronic
951566437 3:24016749-24016771 CTGTGGGATTTCTGGGAGATTGG + Intergenic
957686059 3:83504066-83504088 CTGTGGGCCTCCTGGAATATTGG - Intergenic
958257521 3:91341551-91341573 CACTGGGACTGGTGGGACAGTGG - Intergenic
958465863 3:94457304-94457326 CTGTGTGACTCCTGGAAGATTGG - Intergenic
959721714 3:109498274-109498296 CTGTTAGACTTGTTGGACATGGG + Intergenic
961015515 3:123465353-123465375 CTGTGTCACTCCTGAGACATGGG + Intergenic
961539629 3:127590724-127590746 CTCTGGGACTTGTGGGACTGTGG - Exonic
961732173 3:128973737-128973759 CAGTGGGACCCCTGGGACACAGG - Intronic
964649196 3:158991901-158991923 CTTTGGGACTGGTTGGACAGTGG - Intronic
965511016 3:169568030-169568052 CATTGGGACTCGTTGGACAGTGG + Intronic
972370137 4:38415707-38415729 CTGTGGGCATCGTGGGTCACAGG + Intergenic
973908001 4:55549751-55549773 CTTTGTGACTGATGGGACATAGG - Intergenic
975375585 4:73640397-73640419 CTGTGGGATTGCTGGGTCATAGG + Intergenic
975844074 4:78506757-78506779 CACTGGGACTGGTTGGACATTGG - Intronic
976244113 4:82990376-82990398 CTGCGGGACTTGGGGGATATGGG - Intronic
976585328 4:86790979-86791001 CAATGGGACTCGTTGGACAGTGG + Intronic
977827568 4:101551827-101551849 CTGTGGGCAGCGTGGGCCATGGG - Intronic
981056115 4:140363146-140363168 CTGTGGGACTTGGGGGACATAGG + Intronic
981512638 4:145574454-145574476 CTTTGGGACTGGTTGGACAGTGG + Intergenic
981542389 4:145859470-145859492 CTGTGGGAGTCGTTGGACTGTGG + Intronic
982427998 4:155288709-155288731 CTGAGGCAGACGTGGGACATTGG + Intergenic
983748163 4:171228090-171228112 CTGTGGGACTGGTAGGTCAGGGG - Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
987323825 5:16794594-16794616 CGGAGGGACTCCTGGGCCATGGG + Intronic
987444939 5:18006125-18006147 CATTGGGACTGGTGGGACAGTGG + Intergenic
990440007 5:55834897-55834919 CTTTGGGGCTTTTGGGACATAGG + Intergenic
993251382 5:85528687-85528709 CACTGGGACTCGTTGGACAGTGG - Intergenic
994014955 5:94955074-94955096 CAGTGGGACTGGTTGGACAGTGG + Intronic
997506018 5:134417717-134417739 CTGTGGGACTTGGTGGACAAGGG - Intergenic
997627917 5:135343549-135343571 CTGTGGAACTCCTCGGACACAGG - Exonic
1000068921 5:157721052-157721074 CTTTGGGACTGGTTGGACAGTGG + Intergenic
1000411134 5:160935883-160935905 TTGTGGGCCTCCTGGGATATTGG - Intergenic
1002202377 5:177537116-177537138 CTGTGGTACACGTGGCACAGAGG - Intronic
1006457210 6:34138673-34138695 CTGTGCGACTCGCAGGCCATGGG + Intronic
1008536137 6:52507745-52507767 CTGTGGGACTCGTGGGACATGGG - Intronic
1008997784 6:57679472-57679494 CACTGGGACTGGTGGGACAGTGG + Intergenic
1009186276 6:60578810-60578832 CACTGGGACTGGTGGGACAGTGG + Intergenic
1010385895 6:75279162-75279184 CTCTGGGAATAGTGGGAGATAGG - Intronic
1010980336 6:82364004-82364026 CAGTGGGACTCGGGGTACAGTGG - Intronic
1013860898 6:114633988-114634010 CAGTGGGACTGGTTGGACAGTGG - Intergenic
1013964110 6:115935157-115935179 CAGTGGGACTGGTTGGACAGTGG + Exonic
1014566547 6:122956259-122956281 CTGTGGGCTGCCTGGGACATGGG + Intergenic
1014591456 6:123276941-123276963 CTCTGGGACTGGTGGAACAGTGG - Intronic
1015046332 6:128780252-128780274 CTTTGGGACTGGTTGGACAGTGG - Intergenic
1017677547 6:156829330-156829352 CTGTGGGCCTGGAGGGCCATAGG - Exonic
1018076070 6:160214749-160214771 CATTGGGACTGGTGGGACAGTGG - Intronic
1020635888 7:10695701-10695723 CTTTGGGACTGGTTGGACAGAGG + Intergenic
1020693912 7:11391926-11391948 CATTGGGACTCGTTGGACAGTGG - Intronic
1025022234 7:55488892-55488914 CTGTGGACCACATGGGACATTGG + Intronic
1039154036 8:34535510-34535532 CAGTGGGACTGGTTGGACAGTGG + Intergenic
1040404543 8:47087078-47087100 GTGTGGGACCCGTGGAAGATGGG + Intergenic
1042534019 8:69840890-69840912 CTGTGGGACTTGTGGGGCATGGG + Intergenic
1042619905 8:70693755-70693777 ATGGGGGACTTGTGGGAAATTGG + Intronic
1042659269 8:71135652-71135674 CTGTGGGACTTGCGGGGCAAGGG - Intergenic
1045883288 8:107065512-107065534 CATTGGGACTGGTGGGACAATGG - Intergenic
1052409542 9:28105603-28105625 CTGTGTGACTACTGGGAGATGGG + Intronic
1055642873 9:78334447-78334469 CATTGGGACTGGTTGGACATGGG + Intergenic
1055753835 9:79535691-79535713 CTGTGGGACTTGGGCGACTTGGG + Intergenic
1060343058 9:122793582-122793604 CTGAGGGTGTCTTGGGACATGGG - Intergenic
1060375648 9:123113559-123113581 TTGAGTGACACGTGGGACATTGG - Intronic
1061328515 9:129878474-129878496 CTGGGGGCCTCCTGGGAGATGGG + Intronic
1062589740 9:137268134-137268156 CTGTGGGTCCCATGGGAGATGGG + Intronic
1062611123 9:137373913-137373935 CTGCGGCACTCGCGGGACACGGG + Intronic
1185467363 X:362811-362833 CTGTGGGACCCTTGTGACCTGGG - Intronic
1190047591 X:47125175-47125197 CTGTGGGACTTGGAGGACATGGG - Intergenic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1191705033 X:64085510-64085532 CTTTGGGACTGGTTGGACAGTGG + Intergenic
1192977750 X:76303750-76303772 CTTTGGGAGTGGTTGGACATTGG - Intergenic
1196158968 X:112461916-112461938 CAGTGGGACTTGTTGGACAGTGG + Intergenic
1198335845 X:135665538-135665560 CATTGGGACTCGTTGGACAGTGG - Intergenic
1199178879 X:144828583-144828605 CTGTGATACTCCTGGAACATGGG + Intergenic
1201783285 Y:17745851-17745873 CTTTGGGACTGGTTGGACAGTGG + Intergenic
1201818268 Y:18160136-18160158 CTTTGGGACTGGTTGGACAGTGG - Intergenic