ID: 1008539385

View in Genome Browser
Species Human (GRCh38)
Location 6:52533711-52533733
Sequence TACTAGCTAAAGGACTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008539385_1008539391 -3 Left 1008539385 6:52533711-52533733 CCCCCAAAGTCCTTTAGCTAGTA 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1008539391 6:52533731-52533753 GTAGCTGGCAGAGCCAGACAAGG 0: 1
1: 0
2: 2
3: 33
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008539385 Original CRISPR TACTAGCTAAAGGACTTTGG GGG (reversed) Intronic
901735122 1:11307318-11307340 TACTTCATAAAGGGCTTTGGCGG - Intergenic
903644940 1:24889512-24889534 TGCTAGATAAAGAACTTGGGTGG - Intergenic
905848542 1:41255921-41255943 TACAAGCCAAAGGAGATTGGGGG - Intergenic
905882294 1:41472093-41472115 CACTAGCTAACTGACCTTGGTGG + Intergenic
906462004 1:46041750-46041772 TATTAGTTAAATGACTTTAGAGG + Exonic
907924209 1:58940827-58940849 TACTAACTAAAAGACCTTGGAGG + Intergenic
909594718 1:77393758-77393780 TACTAGCTATGTGACTCTGGAGG - Intronic
909819177 1:80038229-80038251 TGCTAGCAAAAATACTTTGGAGG - Intergenic
913124112 1:115769439-115769461 TAACAGCTAATGAACTTTGGAGG + Intergenic
914401900 1:147328863-147328885 TACTAGGTTAAGGAGTTTTGGGG - Intergenic
919304861 1:195819291-195819313 TATCAGCTTAAGGAGTTTGGGGG + Intergenic
921523483 1:216187318-216187340 TACTATTTAAAGCACTGTGGAGG - Intronic
923491889 1:234491464-234491486 TCCTAGCAAAAGGAATTGGGTGG - Intergenic
1065905952 10:30252048-30252070 AATTAGCTATAGGACTTTGTAGG + Intergenic
1068017943 10:51541822-51541844 TACTAGTTAAAGTAAATTGGAGG - Intronic
1068022830 10:51605638-51605660 TACTTTCTAAAGCACTTTGCAGG - Intronic
1068152232 10:53147255-53147277 TATCAGCTTAAGGAGTTTGGGGG + Intergenic
1069269995 10:66514604-66514626 TACTTGCAAAAGAACTGTGGTGG - Intronic
1070711046 10:78683448-78683470 AACTAGCTGCAGGACTTTGAGGG + Intergenic
1071914435 10:90275616-90275638 TAATAGGGAAAGGACTTTGAGGG + Intergenic
1072930297 10:99656578-99656600 TACCCTCTAAAGGAATTTGGAGG - Intergenic
1077714030 11:4563572-4563594 TACCAGCTTAAGGAGTTTTGAGG - Intergenic
1077955027 11:7008698-7008720 TATTAGCTAAAGGAGCTTTGGGG - Intronic
1078539888 11:12204867-12204889 CACTTGCTAAAGGAATTTGGAGG + Intronic
1079276650 11:19044256-19044278 TACTGGCTTAAGGAGTTTTGGGG - Intergenic
1080442999 11:32312722-32312744 TACAAGTTAAAGGGCTTTAGAGG + Intergenic
1081043482 11:38241291-38241313 TACAAGCTAAAAGAGATTGGGGG - Intergenic
1084925771 11:72510354-72510376 TGCCAGCTAAAGAACTTTGTTGG + Intergenic
1085879797 11:80453015-80453037 TACTAGATCAGGGACTCTGGAGG - Intergenic
1088034337 11:105293673-105293695 TATTAGCTTAAGGAGTTTTGGGG + Intergenic
1088525122 11:110744647-110744669 TACTAGCCAAGTGGCTTTGGGGG - Intergenic
1089287018 11:117413958-117413980 TGCCAGCTTAGGGACTTTGGGGG - Intergenic
1090875288 11:130783653-130783675 TACTGTTTAAAGGACTTTGGAGG + Intergenic
1092706207 12:11287847-11287869 TATTAGCTTAAGGAGTTTTGGGG - Intergenic
1093322707 12:17733907-17733929 AACTAGCCAAAATACTTTGGAGG - Intergenic
1093647824 12:21608919-21608941 AAGTAACTAAAGGACTTTGAGGG + Intergenic
1094009242 12:25789282-25789304 TATTATTTAAAGGACTATGGTGG - Intergenic
1095518446 12:43033685-43033707 TCCTAGTAAAAGGTCTTTGGGGG - Intergenic
1096938168 12:55307345-55307367 TATTAGCTTAAGGAGTTTTGGGG - Intergenic
1098841591 12:75484427-75484449 TACTAGCTAAATGACATCAGGGG - Intronic
1098872292 12:75830039-75830061 TACTAGCCAAAGGAGTTTTTGGG - Intergenic
1099061155 12:77910831-77910853 TTCAAGCAAAATGACTTTGGTGG - Intronic
1099744587 12:86686236-86686258 TATCAGCTTAAGGAGTTTGGGGG + Intronic
1100696583 12:97100526-97100548 TTCTTGCTAAAGGGCTTGGGTGG - Intergenic
1103958353 12:124592248-124592270 TCCCAGCCCAAGGACTTTGGTGG + Intergenic
1107244296 13:38274164-38274186 TATCAGCTTAAGGAGTTTGGGGG - Intergenic
1107824305 13:44313687-44313709 TTCTAGATAAAGAAGTTTGGTGG + Intergenic
1109074912 13:57822430-57822452 TACTAGCACAGAGACTTTGGAGG + Intergenic
1109372356 13:61439856-61439878 TATTAGCTTAAGGAGTTTTGGGG - Intergenic
1109628949 13:65018442-65018464 TATCAGCTTAAGGAGTTTGGGGG + Intergenic
1110458285 13:75714851-75714873 TAATAGCTAAAGTAGTTTGCAGG - Intronic
1111145100 13:84169118-84169140 TACAAGCCAAAGGAAATTGGGGG - Intergenic
1113752136 13:112783776-112783798 TACGAGCTAAAGTATTTTTGTGG + Intronic
1115340589 14:32289641-32289663 TATTAGCTTAAGGAGTTTGGGGG + Intergenic
1117732333 14:58736060-58736082 ATCTGGCAAAAGGACTTTGGAGG + Intergenic
1118123372 14:62871379-62871401 TACTTGCTAAAGTTGTTTGGTGG + Intronic
1120209550 14:81621508-81621530 TCCTAGCTAAAAGATTATGGAGG + Intergenic
1129194418 15:73955593-73955615 TACTAAGTAAATGACTCTGGTGG + Intergenic
1134909137 16:18008398-18008420 TGCTACCCAAAGAACTTTGGAGG - Intergenic
1137685583 16:50384638-50384660 GACTAGCTAAAGGGTTTTGCTGG + Intergenic
1138837436 16:60455867-60455889 TATCAGCTTAAGGAGTTTGGGGG + Intergenic
1140157491 16:72447148-72447170 TCCTAGCTAAAGCAGTTAGGGGG - Intergenic
1143883893 17:10051938-10051960 TAGTAGCTAAAGGACTACTGTGG + Intronic
1144137716 17:12314421-12314443 TACCAGCCAAAGCACTTTGTTGG + Intergenic
1146760476 17:35473029-35473051 TATCAGCTTAAGGAATTTGGAGG + Intronic
1147252920 17:39164560-39164582 TCCTAAGTAAAGTACTTTGGAGG + Intronic
1148199269 17:45739149-45739171 TACCAGCTGAAGGACATTTGGGG + Intergenic
1149010452 17:51851145-51851167 TATTAGCTATGTGACTTTGGAGG + Intronic
1149954183 17:61027686-61027708 TACTAGCTATATGATTTGGGGGG + Intronic
1150542779 17:66120536-66120558 TAATAGCTATAGGACTATGCAGG + Intronic
1150565908 17:66339718-66339740 TTCTATTTAAAGGTCTTTGGGGG - Intronic
1150874170 17:68950056-68950078 TACCAGCTTAAGGAGTTTTGGGG - Intronic
1152017718 17:77762646-77762668 TACTAGCTATATAATTTTGGGGG - Intergenic
1152083646 17:78204467-78204489 TGCTAGCTACGGGACCTTGGGGG - Intronic
1153531473 18:6051063-6051085 TACTAGCAAAAGGAGTTCTGCGG - Intronic
1154376919 18:13818480-13818502 TTGTAGCTAAAGGACTGTGCAGG + Intergenic
1155473621 18:26215949-26215971 TTCTAGCTTAAGAACTTGGGTGG - Intergenic
1159908665 18:74122560-74122582 CACTAGATGAAAGACTTTGGAGG + Intronic
1162311490 19:9910267-9910289 TACTAGCTGTGTGACTTTGGGGG - Intronic
1167778711 19:51581127-51581149 AATTAGCTAAAGGACTTAGAGGG + Intronic
926834006 2:16997987-16998009 TACCAGCTCAAGGAGTTTGGGGG + Intergenic
930006045 2:46898109-46898131 TCCTGGCTATAGGACTTGGGTGG + Intergenic
930175628 2:48298572-48298594 TACAAGCTTAAGGAGTTTTGAGG + Intergenic
930552098 2:52848735-52848757 TATCAGCTTAAGGAGTTTGGGGG + Intergenic
930926167 2:56820705-56820727 TATCAGCTTAAGGATTTTGGGGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
936900515 2:117476832-117476854 TATTAGCTTAAGGACTTTTTGGG - Intergenic
937360936 2:121229795-121229817 TAGTTGCTGAATGACTTTGGGGG - Intronic
937568349 2:123324940-123324962 TACTAGCTAATGGAATTTAATGG - Intergenic
938874531 2:135518716-135518738 TACAAGTTACAGGACTATGGTGG - Intronic
941566398 2:167113964-167113986 TACAAGCTAGATGAATTTGGGGG - Intronic
942353996 2:175087135-175087157 TACAACCAGAAGGACTTTGGAGG - Intronic
946466344 2:219915259-219915281 TTCTAGCTTAATGATTTTGGGGG + Intergenic
946560570 2:220907886-220907908 TATTTTGTAAAGGACTTTGGTGG + Intergenic
948361298 2:237422346-237422368 CACAAGCTAAGGGACTCTGGGGG - Intronic
1168921675 20:1542516-1542538 TATTAGCTTAAGGAGTTTTGGGG + Intronic
1169055772 20:2619567-2619589 TACTAGATAAAGGCCTGTGATGG + Intronic
1170493569 20:16902362-16902384 TACTAGCTCTATGACCTTGGGGG + Intergenic
1173233758 20:41224815-41224837 TCCTATCTAAATGTCTTTGGGGG + Intronic
1174997339 20:55585306-55585328 TACTAGCTATGAGACTTTAGAGG + Intergenic
1184415065 22:44347481-44347503 GACAAGCCAAAGGACCTTGGGGG + Intergenic
950135843 3:10580274-10580296 TACCAGCTACATGACTCTGGGGG + Intronic
950201760 3:11049527-11049549 TAAGAGCTAAAGGAGTTTGGAGG + Intergenic
953262966 3:41358123-41358145 CTCTAGCTACAGGACATTGGAGG + Intronic
957548159 3:81667323-81667345 TATCAGCTAAAGGAGTTTTGGGG + Intronic
958093200 3:88904057-88904079 TATTAGCTTAAGGAGTTTTGGGG + Intergenic
958607162 3:96373896-96373918 TACCAGCTTAAGGAGTTTTGGGG + Intergenic
959599934 3:108170262-108170284 TATTAGCTTAAGGAGTTTTGGGG - Intronic
962664484 3:137640004-137640026 TACTAGATTTAGGATTTTGGGGG + Intergenic
963189684 3:142455443-142455465 TAATAGCTAAATGATCTTGGGGG + Intronic
973873794 4:55193737-55193759 TACCAGCTTAAGGAGTTTTGGGG - Intergenic
976095350 4:81502575-81502597 AACTAGAAAAAGGACTTGGGTGG - Intronic
977382690 4:96296614-96296636 TAGTTGCTACAGGAATTTGGAGG - Intergenic
977793386 4:101133362-101133384 TATCAGCTTAAGGACTTTTGGGG - Intronic
978823392 4:112992092-112992114 TAGAAGCTAAAGGAGTTTTGAGG - Intronic
979421775 4:120513380-120513402 TATCAGCTTAAGGAGTTTGGGGG - Intergenic
982352033 4:154426184-154426206 TAGTCACTCAAGGACTTTGGTGG - Intronic
984228735 4:177067221-177067243 TACTAGTTACGTGACTTTGGGGG - Intergenic
987275547 5:16358404-16358426 TACCAGCTTAAGGAGTTTTGGGG + Intergenic
988110844 5:26817022-26817044 TACCAGCTTAAGGAGTTTTGGGG - Intergenic
989518301 5:42370271-42370293 GACTATCTAAAGGACAGTGGAGG + Intergenic
993417254 5:87650333-87650355 TACTTGGTGAAGGATTTTGGAGG + Intergenic
994978272 5:106839586-106839608 TATTAGCTTAAGGAGTTTTGTGG + Intergenic
994990928 5:106996161-106996183 TATTAGCTTAAGGAGTTTTGTGG + Intergenic
995070190 5:107912293-107912315 TACTAGCTATGGGACCTTAGAGG - Intronic
996377841 5:122832986-122833008 CACTGGCTCAGGGACTTTGGAGG + Intergenic
997054092 5:130419882-130419904 TATCAGCTTAAGGAGTTTGGGGG - Intergenic
997067922 5:130583875-130583897 TATTAGCTTAAGGAGTTTTGGGG - Intergenic
998691182 5:144590322-144590344 TACCAGCTTAAGGAGTTTTGGGG + Intergenic
999557182 5:152756212-152756234 TATTAGCTTAAGGAGTTTTGGGG - Intergenic
999834351 5:155353004-155353026 TGCTAGCAAAAGTGCTTTGGTGG - Intergenic
1000381060 5:160629773-160629795 TACTAGCTCTGTGACTTTGGTGG - Intronic
1000821989 5:165996294-165996316 TTCTTGCTGAAGGACTCTGGAGG + Intergenic
1001190291 5:169624054-169624076 TACCAGCTTAAGGAGTTTTGGGG + Intergenic
1002873815 6:1192153-1192175 CACTAGCTATGTGACTTTGGGGG + Intergenic
1003770652 6:9295571-9295593 TATCAGCTTAAGGAGTTTGGGGG + Intergenic
1006922359 6:37635187-37635209 TACTTTTTAAAGGACTCTGGTGG + Exonic
1007964568 6:45991944-45991966 TACTTCCTAAAAGACTTTAGGGG + Intronic
1008539385 6:52533711-52533733 TACTAGCTAAAGGACTTTGGGGG - Intronic
1009264718 6:61538766-61538788 TACTATCCAAAGGGCTTTGAAGG + Intergenic
1010105908 6:72167615-72167637 TAATAGCTAAAGGACTATTCGGG + Intronic
1012073293 6:94651043-94651065 TACTAGCTAACAGGCTTTTGTGG + Intergenic
1013694071 6:112680284-112680306 TTCTAGCTAAAGTACTCTGATGG + Intergenic
1014073072 6:117205221-117205243 GACAAGCTGGAGGACTTTGGAGG - Intergenic
1014385296 6:120793237-120793259 TATTAGCTTAAGGAGTTTTGGGG + Intergenic
1014590295 6:123258012-123258034 TACCAGCTCAAGGAGTTTTGGGG + Intronic
1018032713 6:159855158-159855180 TCCTAGCTGAAGGCCGTTGGGGG + Intergenic
1018035912 6:159880902-159880924 TACTTACTAAATGATTTTGGTGG - Intergenic
1021161084 7:17273472-17273494 TACAAGATACAGGACTATGGAGG + Intergenic
1023666612 7:42529068-42529090 TACTAGCCAAAAGACACTGGGGG + Intergenic
1028552642 7:92087516-92087538 TACTAGTAATAGGTCTTTGGAGG - Intronic
1030781164 7:113601912-113601934 TATTAGCTTAAGGAGTTTTGGGG - Intergenic
1030827900 7:114184437-114184459 TTTTAGCTATAGGACATTGGGGG + Intronic
1034059650 7:148075099-148075121 AAATAGCTATAGGACTTTGTAGG - Intronic
1034109108 7:148519249-148519271 TACCAGCTTAAGGAGTTTTGGGG + Intergenic
1034375179 7:150636540-150636562 TATTAGCTTAAGGAGTTTTGGGG + Intergenic
1041679385 8:60572774-60572796 TATAAGCTAAAGCTCTTTGGGGG - Intronic
1041966089 8:63678847-63678869 TAATAGTTACAGGACTTTTGAGG + Intergenic
1042742821 8:72070080-72070102 GAATAGCTATAGGACTTTGCAGG - Intronic
1042753893 8:72188445-72188467 TATCAGCTAAAGGAGTTTTGGGG - Intergenic
1042758575 8:72245863-72245885 GAATAGCTATAGGACTTTGCAGG - Intergenic
1045362038 8:101441858-101441880 TACTAGCTGGATGACCTTGGGGG - Intergenic
1046254229 8:111675159-111675181 TATTAGCTTAAGGAGTTTGGGGG + Intergenic
1047995558 8:130331699-130331721 TACTAGCTACATGATTTTGAGGG - Intronic
1050471138 9:5991778-5991800 TTCTAACTGAAAGACTTTGGAGG - Intronic
1052659491 9:31410022-31410044 TATCAGCTTAAGGAGTTTGGGGG + Intergenic
1055344738 9:75323576-75323598 TATTAGCTTAAGGAATTTTGGGG + Intergenic
1056502380 9:87222628-87222650 AACATGCTAAAGGCCTTTGGTGG + Intergenic
1058386182 9:104438719-104438741 TATTAGCTTAAGGAGTTTTGGGG + Intergenic
1186136666 X:6528832-6528854 AACTAGTTGAAGGGCTTTGGGGG - Intergenic
1186267676 X:7849598-7849620 AACTAGTTGAAGGGCTTTGGGGG + Intergenic
1186297382 X:8165271-8165293 AACTAGTTGAAGGGCTTTGGGGG - Intergenic
1186376824 X:9011986-9012008 AACTAGTTGAAGGGCTTTGGGGG + Intergenic
1189584510 X:42444461-42444483 TACTCCCTAAAAGAATTTGGTGG - Intergenic
1191624517 X:63255962-63255984 TATTAGCTTAAGGAGTTTTGTGG - Intergenic
1192957712 X:76091120-76091142 TACTAGCTTAAGGAGATTTGGGG + Intergenic
1193303867 X:79926253-79926275 TATTAGCTTAAGGAGTTTTGAGG - Intergenic
1194517699 X:94877280-94877302 TACCAGCTAAAGCACTTTTTTGG + Intergenic
1195015141 X:100771168-100771190 TATTAGCTTAAGGAGTTTTGGGG + Intergenic
1195209120 X:102634654-102634676 TATTAGCTAAAGGAAATTTGGGG - Intergenic
1195812022 X:108844680-108844702 TACCAGCTTAAGGAGTTTTGGGG + Intergenic
1195820498 X:108940286-108940308 TATTAGCTTAAGGAGTTTTGGGG + Intergenic
1197123901 X:122922269-122922291 TATCAGCTTAAGGAGTTTGGTGG + Intergenic
1197593597 X:128440250-128440272 TACTAGCTATAGGATATTGGGGG - Intergenic
1199401857 X:147407639-147407661 TATCAGCTTAAGGAGTTTGGGGG - Intergenic
1200907863 Y:8503218-8503240 TACTAGCTTAAGGAGATTTGGGG + Intergenic
1201438004 Y:13980102-13980124 AACTAGTTGAAGGGCTTTGGGGG - Intergenic