ID: 1008539861

View in Genome Browser
Species Human (GRCh38)
Location 6:52537258-52537280
Sequence CTGTATATTCGGATAGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008539861_1008539871 16 Left 1008539861 6:52537258-52537280 CCAAGCCCTATCCGAATATACAG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1008539871 6:52537297-52537319 CCCTAAAACCTTATTACCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008539861 Original CRISPR CTGTATATTCGGATAGGGCT TGG (reversed) Intronic
911803345 1:102173817-102173839 TTGTATTTTTGGATATGGCTTGG + Intergenic
920385554 1:205568643-205568665 CTGTATCTCCGGATAAGGCTAGG - Intergenic
1073244435 10:102079592-102079614 CTTTAAATTGAGATAGGGCTGGG - Intergenic
1075220275 10:120578656-120578678 TTGTATATTTGGAGTGGGCTGGG - Intronic
1076547247 10:131253617-131253639 CTGTTTGTTAGGATTGGGCTGGG + Intronic
1079576114 11:22004744-22004766 CAGTATAATGGGGTAGGGCTTGG - Intergenic
1085915988 11:80888417-80888439 CAGTATATTTTGAAAGGGCTGGG + Intergenic
1086928841 11:92670367-92670389 TTGTATAATTGGATAGGGATAGG - Intronic
1090412253 11:126517446-126517468 CTGAGTCTTCGGAGAGGGCTAGG + Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1111700529 13:91682550-91682572 CTGTACATTCTGATAGGGTTTGG - Intronic
1115629564 14:35230357-35230379 CTGTAAATTCTGATAGAGATGGG + Intronic
1121641874 14:95490182-95490204 CTTTACATTGGGATAGGGCAGGG - Intergenic
1126878170 15:53066471-53066493 CTGGAGATTCAGATAGGCCTGGG - Intergenic
1155667397 18:28327816-28327838 CTGTATATTGGGATATTGCAGGG + Intergenic
1165654190 19:37518969-37518991 CTAAAAATTCTGATAGGGCTGGG + Intronic
1168400605 19:56084207-56084229 CTGTATACCCGGGTGGGGCTGGG - Intergenic
925868878 2:8252293-8252315 GTGTACTTTCTGATAGGGCTTGG - Intergenic
930542716 2:52727597-52727619 CTGTATATTATGATATGGCTAGG + Intergenic
1170457271 20:16544822-16544844 CTGTATATGAGGACAGTGCTAGG - Intronic
1184204323 22:42991583-42991605 CTCTATCATTGGATAGGGCTGGG - Intronic
951787564 3:26439227-26439249 CTGTGTATTCCAATAGGGCCAGG - Intergenic
955943988 3:64173828-64173850 CTGGAGATTCGGAAAAGGCTGGG - Intronic
967961261 3:194926287-194926309 TTGTATATTTGGATGGGGCAGGG + Intergenic
968740266 4:2325280-2325302 CTGTACATTCACATAGGGCTTGG - Intronic
969919822 4:10527221-10527243 CTGTATTGTCGGAAAGGGCATGG + Intronic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
982793498 4:159618994-159619016 CTGTAGATTCTGGTAGGGCATGG + Intergenic
984680846 4:182607787-182607809 CTGTATATTCTGATAATGTTTGG + Intronic
993602957 5:89952054-89952076 CTGTGAATTCTGAGAGGGCTGGG - Intergenic
998677239 5:144423473-144423495 ATGTATTTTCTGAAAGGGCTGGG - Intronic
1002172536 5:177383589-177383611 CTGGATCTTTGGCTAGGGCTGGG - Intronic
1004370910 6:15051434-15051456 GTGTATAATGGGATGGGGCTGGG - Intergenic
1006920728 6:37625503-37625525 CTGTAAATTGGGAGAAGGCTGGG - Intergenic
1008539861 6:52537258-52537280 CTGTATATTCGGATAGGGCTTGG - Intronic
1008946954 6:57108678-57108700 CTATATATTCTGACAGGTCTTGG + Intronic
1014829493 6:126085283-126085305 CTGTACATTCTGCTAGGGCAGGG + Intergenic
1048386996 8:133921464-133921486 CTGAATATTCACAGAGGGCTTGG + Intergenic
1048684171 8:136883767-136883789 CTGTTCATTTGGATAGGTCTAGG + Intergenic
1058656436 9:107225912-107225934 ATGTGTATTCAGATAGGGCTTGG + Intergenic
1186561145 X:10614670-10614692 CTATATATTAGGACAGGCCTGGG + Intronic
1190751803 X:53368460-53368482 CTGTATATGGGGGCAGGGCTAGG - Intergenic
1197590968 X:128409542-128409564 CTGTATTTACGGATAGCCCTTGG - Intergenic