ID: 1008540939

View in Genome Browser
Species Human (GRCh38)
Location 6:52546002-52546024
Sequence AACAGAATCATCATTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008540938_1008540939 19 Left 1008540938 6:52545960-52545982 CCAGACAGATAAATCAGTATGCA 0: 1
1: 0
2: 2
3: 31
4: 182
Right 1008540939 6:52546002-52546024 AACAGAATCATCATTCTCACAGG 0: 1
1: 1
2: 2
3: 24
4: 238
1008540937_1008540939 20 Left 1008540937 6:52545959-52545981 CCCAGACAGATAAATCAGTATGC 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1008540939 6:52546002-52546024 AACAGAATCATCATTCTCACAGG 0: 1
1: 1
2: 2
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008540939 Original CRISPR AACAGAATCATCATTCTCAC AGG Intronic
902954445 1:19915497-19915519 AATAGAACCATCAGCCTCACAGG - Intergenic
903002790 1:20278228-20278250 AACAGAATCATCTCTCACAAGGG - Intergenic
903456826 1:23493278-23493300 AACATAATCATCATCCTGACTGG - Intergenic
905778520 1:40687123-40687145 CACAGAAGCATCATTCACAGTGG + Intergenic
906521910 1:46472248-46472270 AACTGAATAATCATTCTTAAAGG + Intergenic
906577525 1:46904164-46904186 AAAGGAATCATCATTCATACTGG + Intergenic
908221980 1:62016085-62016107 ACCAAGATCATCAATCTCACCGG - Intronic
908712394 1:67031168-67031190 AACAGAAAAATAATTCTCATGGG + Intronic
909212937 1:72847256-72847278 AACAGAAACACCATGCACACAGG + Intergenic
909416408 1:75410936-75410958 GACAAAATTCTCATTCTCACTGG - Intronic
910302689 1:85724843-85724865 GACAGAGTAATCATTCTAACAGG + Intergenic
910686541 1:89923025-89923047 AACAGGATCATAATTCTAAAAGG + Intronic
910944124 1:92570140-92570162 AACAAAATCATTATTCTCATAGG + Intronic
911580694 1:99630207-99630229 AATAGAATCTTCATTCTGCCTGG - Intergenic
912932803 1:113979904-113979926 AACAGAATCATCACCTTCTCTGG - Intronic
914387546 1:147185822-147185844 AACAGAATCATCAGTGGCACTGG + Intronic
917649503 1:177063002-177063024 ACCAGTATCATCATCCTCAGAGG - Intronic
919273578 1:195383666-195383688 ATCATAATCATAATTCTAACTGG - Intergenic
919560799 1:199115821-199115843 AACAGAATCCTCAATGTCAGAGG - Intergenic
920994147 1:210971105-210971127 AAAAAAATCATCATTCTGACTGG - Intronic
922911285 1:229219992-229220014 AGCAGAAAAAGCATTCTCACTGG + Intergenic
923488620 1:234461712-234461734 AACAGTAACATCTTTCTCATAGG + Intronic
924863527 1:247952612-247952634 AACAGAAACATATTTCTCAGAGG - Intronic
1063061980 10:2565327-2565349 AACAGAATCCACATCCTCAGAGG - Intergenic
1063587293 10:7363892-7363914 AACAGAAACATCATACACCCTGG + Intronic
1063597910 10:7453803-7453825 AACAGAATTATCATTCAACCTGG + Intergenic
1067767044 10:49094757-49094779 AACTGGATCAACATTCTCAGTGG + Intronic
1069089817 10:64186489-64186511 AACAGAATCATTGCTCACACTGG - Intergenic
1070196677 10:74163400-74163422 AAGAGATTCATCATTCTAACAGG - Intronic
1070382225 10:75891379-75891401 ATCAGAATCAGCATTTTCAGAGG + Intronic
1070555135 10:77521728-77521750 AACCGAGTCATCACTCTCAAGGG - Intronic
1071081847 10:81822262-81822284 CAGATAATCACCATTCTCACTGG + Intergenic
1071712081 10:88059896-88059918 TTCAGAATCATCATTGTAACAGG + Intergenic
1072899987 10:99398753-99398775 AATAGAATCATCATAATCAGAGG + Intronic
1073682619 10:105720455-105720477 AACAGAATCATCTTTGTCTCTGG - Intergenic
1080178256 11:29393115-29393137 AAAGGAAACTTCATTCTCACTGG + Intergenic
1080883552 11:36345124-36345146 AACACAACCATCAGTCCCACGGG - Intronic
1081142010 11:39513146-39513168 AACAGAAATTTCTTTCTCACAGG + Intergenic
1082299810 11:50492155-50492177 ACAAGAATCACCATTCACACTGG - Intergenic
1086885161 11:92197363-92197385 AACAGAATGATCCTTCTCTTTGG - Intergenic
1088062493 11:105672021-105672043 AACAGCTTAATCACTCTCACTGG + Intronic
1092577787 12:9808049-9808071 AACAGAAGCATCATTATTAGAGG - Intergenic
1093179470 12:15950829-15950851 AACAAAATCCTTATTCTCATAGG - Intronic
1093444496 12:19240944-19240966 AACAGAATAAAAATGCTCACAGG - Intronic
1093550839 12:20408902-20408924 TCCAGAATCCTCATTCTCAATGG - Intronic
1095090310 12:38098503-38098525 AACATAAACCTCATTATCACTGG + Intergenic
1096729096 12:53592114-53592136 AGCAGAATCAGCAGTCACACAGG + Intronic
1097158984 12:57032344-57032366 AACAAAGTCTTCATTTTCACTGG + Intronic
1098516697 12:71385863-71385885 ATCAGAATAATCATTTTCTCTGG + Intronic
1098867733 12:75781962-75781984 AACACCATCATCATTCTTTCAGG + Intergenic
1099012699 12:77310661-77310683 ATCAGAATCTTCATTTTCAGTGG - Intergenic
1099052643 12:77799521-77799543 AGCATAATCATCATTGTCAAGGG - Intergenic
1099745418 12:86696496-86696518 AACAGAATCATATTTCTCAAAGG - Intronic
1100911138 12:99365060-99365082 AACAGAATGATCATTCCCAGAGG + Intronic
1106300744 13:28462613-28462635 ATCATTATCATCATTCTCTCTGG - Intronic
1106687707 13:32078805-32078827 AACAGAATGGGCATTCTTACTGG - Intronic
1107631533 13:42348182-42348204 AACAGAATCTTCATTAAGACTGG - Intergenic
1108746508 13:53400636-53400658 AACTGAATCATCTTTTTCTCTGG + Intergenic
1109369172 13:61398768-61398790 AAAAAAATCATCATTCTGACTGG + Intergenic
1109933879 13:69254449-69254471 AACAGAGTCATGATTTTCAGTGG + Intergenic
1110098333 13:71561100-71561122 AGCACGATCATCATTCTCACTGG - Intronic
1110471322 13:75863326-75863348 AAAACAATCGTTATTCTCACAGG + Intergenic
1110674785 13:78228689-78228711 ATCAAAATCATCATTTTCAGAGG + Intergenic
1111865425 13:93762368-93762390 AGCATAATGATCATTCTCTCAGG + Intronic
1113083258 13:106539284-106539306 AAGAGAATCATTCTTCTCTCTGG + Intergenic
1116180514 14:41526357-41526379 AAAAAAATCACCATTCTGACTGG + Intergenic
1116307449 14:43276137-43276159 AACAAAAACATTATTCTCACTGG - Intergenic
1117195612 14:53337029-53337051 TACAGAATCCTCATTACCACAGG - Intergenic
1118213977 14:63790825-63790847 AATGGAAACTTCATTCTCACTGG + Intergenic
1118320854 14:64752566-64752588 AATAGAAACATCAATGTCACAGG + Intronic
1121642045 14:95491361-95491383 AATAGAATGATCCTTCTCAGAGG - Intergenic
1121946473 14:98127634-98127656 AACAGAAGAATAATTCCCACTGG - Intergenic
1124510041 15:30316116-30316138 AACAGAATCATCCTTATTGCTGG + Intergenic
1124732849 15:32214437-32214459 AACAGAATCATCCTTATTGCTGG - Intergenic
1126134084 15:45374321-45374343 TACAGAATCAGAATTCTCAGAGG - Intronic
1126252493 15:46585268-46585290 AACAGAATGATAATTATCAGAGG - Intergenic
1126328896 15:47510788-47510810 AAAAGCATCATCATTCTTCCAGG - Intronic
1126934790 15:53694858-53694880 AGAACAATCATCATTCTCAGGGG + Intronic
1127192569 15:56546758-56546780 AGGAGAATCAGCATTCTCCCTGG + Intergenic
1127702583 15:61515294-61515316 AGCAGAATAATCAATCTCACTGG - Intergenic
1128414586 15:67433307-67433329 AACAGAATTGTAATTTTCACTGG - Intronic
1130388809 15:83436601-83436623 AACAGAACCTGCATTCTAACCGG + Intergenic
1134036547 16:11035786-11035808 AACAAAATCACCAGTCTCTCTGG - Intronic
1134638148 16:15808332-15808354 AGCACAGTCATCATCCTCACGGG + Intronic
1136870936 16:33807634-33807656 AAAAGTATCATAATTCTCAAGGG + Intergenic
1138273345 16:55712049-55712071 AACAGAATCATGGTTCTCTTAGG + Intergenic
1138919062 16:61504360-61504382 AACAGAATTATCAAACACACTGG + Intergenic
1140245068 16:73240862-73240884 AAAAGGATCATCAAACTCACAGG + Intergenic
1140292859 16:73679352-73679374 AGCAAAAACATCTTTCTCACTGG - Intergenic
1203101236 16_KI270728v1_random:1308424-1308446 AAAAGTATCATAATTCTCAAGGG - Intergenic
1144049744 17:11488265-11488287 GTCAGAATCATCACACTCACTGG + Intronic
1144936154 17:18900790-18900812 AAAAGTAGCATCATTCTCATTGG + Intronic
1145209322 17:21001626-21001648 AACAGGATCATCTGTCTCAGCGG - Exonic
1145758257 17:27408597-27408619 CACAGATTGATGATTCTCACAGG - Intergenic
1146991635 17:37279139-37279161 AAGATAATCACCATTCTGACTGG - Intronic
1147036829 17:37687851-37687873 ACCAGAATCCACATTTTCACAGG - Intronic
1148044212 17:44732525-44732547 AACAGGATCATCATACTAGCTGG - Intronic
1148782064 17:50128143-50128165 CACAGGATCTTCATTCTCAGAGG - Intronic
1149947163 17:60941947-60941969 AATAGAAACATCATTCTGACAGG - Intronic
1150647753 17:66990399-66990421 AATTGAATCATCATATTCACAGG + Intronic
1151152931 17:72103653-72103675 AACAACATCATCTTTCTCACGGG + Intergenic
1154405594 18:14087220-14087242 AACAGAACCATCATACTGAATGG + Intronic
1155134549 18:22976149-22976171 AGTAGAATTATCATTCTTACTGG + Intronic
1155377188 18:25173098-25173120 CTCAGATTTATCATTCTCACTGG - Intronic
1155431068 18:25758990-25759012 AACAGCATCATCACTTTAACAGG + Intergenic
1156878601 18:42047615-42047637 ATCAGAATCTTCATTCTAACAGG + Intronic
1157064445 18:44331297-44331319 AACAGAATTATCATTCAACCTGG - Intergenic
1158592801 18:58791700-58791722 AACAGAATTTTGTTTCTCACAGG - Intergenic
1159290540 18:66413195-66413217 AACAGAATTACCATTTTAACAGG + Intergenic
1164778662 19:30874229-30874251 AACGGCAGCATCGTTCTCACTGG - Intergenic
1166217707 19:41346704-41346726 AAAGAAATCCTCATTCTCACTGG - Intronic
1166989857 19:46685623-46685645 AAAGGAATCATGGTTCTCACAGG - Intronic
1167873826 19:52395335-52395357 ATCAGAATCATCATACAAACTGG - Intergenic
925751299 2:7092046-7092068 AAGAGGATCATCTTTCTCACTGG - Intergenic
926498223 2:13618065-13618087 AACAAAATGATGTTTCTCACTGG + Intergenic
927026675 2:19075225-19075247 AACAGAGTAACCAATCTCACTGG + Intergenic
928785637 2:34883151-34883173 AAAAAAATCATCAGTCACACAGG - Intergenic
929449235 2:42025565-42025587 AACAGACTCCACATTCTCCCTGG - Intergenic
930390194 2:50751357-50751379 AACAGAAAAATAATTCTCTCTGG + Intronic
930400038 2:50872626-50872648 AATAAAATAATCACTCTCACTGG + Intronic
930713720 2:54573404-54573426 ATCAGCAGCAGCATTCTCACAGG - Intronic
930877628 2:56236929-56236951 AACAGAATCATCATTCTTACAGG - Intronic
931644248 2:64406946-64406968 AAGAGAATCATAATTCTCCTGGG - Intergenic
931876235 2:66516354-66516376 ATCAGAATCACCATTCCGACTGG - Intronic
932055102 2:68435328-68435350 AGGAGAATCATCATTTTCATTGG - Intergenic
932231579 2:70087909-70087931 GAGAGAATCATCACTCTGACCGG + Exonic
934507054 2:94903019-94903041 AATAGCATCATCTTTCCCACTGG - Intergenic
935737101 2:106115046-106115068 TGCTGAATCCTCATTCTCACTGG + Intronic
940117916 2:150230171-150230193 GACTTAATCATCATTCACACAGG - Intergenic
942741254 2:179181084-179181106 AACTGATTCATCATTTACACTGG + Intronic
943683180 2:190789256-190789278 AACAAACTCATCAATCTCATGGG + Intergenic
944332251 2:198484193-198484215 AACACAATCATCTTTATAACTGG - Intronic
944548337 2:200820762-200820784 AACAGAAGCAGGATTCACACAGG - Intronic
945871452 2:215231202-215231224 AACAGAATAATCATTATATCTGG + Intergenic
947138957 2:227003199-227003221 CACAGAATTATGATTCTCACAGG - Exonic
947861036 2:233357455-233357477 ACCATAATCATCATTTTAACAGG - Intronic
947990793 2:234485891-234485913 AACAGCAGCATCAGCCTCACTGG + Intergenic
948035416 2:234854519-234854541 AACAGGACCTTCCTTCTCACTGG + Intergenic
949064985 2:241984694-241984716 AACAGAGGCATCCTTCTCATGGG - Intergenic
1170374441 20:15685049-15685071 AACATTATTATTATTCTCACTGG + Intronic
1170798910 20:19574146-19574168 AATAGAATCATCATTTTCCTTGG + Intronic
1170882706 20:20311234-20311256 ATTAGAACCATCATCCTCACTGG - Intronic
1172002472 20:31790271-31790293 AGCAGAATGAGCATTCTCAGTGG + Intronic
1173152601 20:40580688-40580710 AACTGCAACATCCTTCTCACTGG + Intergenic
1175420761 20:58831060-58831082 AACAAAAACATCAATCTAACTGG + Intergenic
1177738823 21:25127882-25127904 AACTGAATCATTCTTCTCTCTGG + Intergenic
1181656265 22:24302363-24302385 AACAGCAGCATCATTGTCAAAGG + Exonic
1182964572 22:34509153-34509175 AACAGACTAATCATCCCCACGGG + Intergenic
1183111927 22:35656497-35656519 AACAGAATCAGCCCTCTCCCTGG - Intronic
1183263664 22:36812552-36812574 AATAGAATGATAATTCTTACAGG - Intronic
949392122 3:3573893-3573915 AACATATTCATCACCCTCACGGG + Intergenic
949835672 3:8266976-8266998 AACATAATTAACATTCTCAGTGG + Intergenic
951637524 3:24795955-24795977 AACAGATTCTTAATTCTCATTGG + Intergenic
952549010 3:34454786-34454808 TAAACAATCATCATTCTAACTGG + Intergenic
952773099 3:37020053-37020075 AACAGAATTACCTATCTCACAGG - Intronic
954874684 3:53794116-53794138 AACATAATTATTATTCTCAAAGG - Intronic
955253915 3:57310090-57310112 AAGAGAATGACCCTTCTCACTGG + Intronic
955978900 3:64505010-64505032 ATCACCATCATCATTCTCATTGG - Intergenic
956677768 3:71752237-71752259 ATCAGAATCTTCATTTTAACAGG + Intronic
956797426 3:72729354-72729376 CCAAGAATCTTCATTCTCACAGG - Intergenic
957227483 3:77468642-77468664 AACACAAACATAATTCACACAGG - Intronic
958989754 3:100829104-100829126 AACAGAAAAATCATTCTCAGGGG - Intronic
959663160 3:108891950-108891972 AACAGAACAAACACTCTCACAGG + Intergenic
960344998 3:116520037-116520059 AAAAGAATCATCATTCTGACTGG + Intronic
960913146 3:122669166-122669188 AACAGATTCCACATCCTCACTGG - Intergenic
961175730 3:124833724-124833746 AACAAAGGCTTCATTCTCACAGG - Intronic
963236208 3:142959550-142959572 AAGTGAATCCTCATTCTCTCTGG + Intronic
963313288 3:143731630-143731652 AAGAGAATCATGTTTGTCACGGG - Intronic
963432125 3:145220899-145220921 TACAGCATCATAATTCTGACTGG - Intergenic
963433462 3:145239415-145239437 AAGAGAAACATAATTCTAACTGG + Intergenic
963881890 3:150537778-150537800 ATCAGAATCTGCATTTTCACAGG - Intergenic
964233828 3:154501365-154501387 GACACAATCCTCATTTTCACAGG + Intergenic
965550992 3:169965102-169965124 AACAGATTCATCATTCTGGGTGG + Intergenic
968255710 3:197268937-197268959 GCCAGAATCATCAGTATCACTGG + Intronic
969273823 4:6121237-6121259 ATCAGCATCATCATTCTCACTGG + Intronic
971835730 4:31760523-31760545 AACAGAAGCAACATTTTCATAGG + Intergenic
972335099 4:38100782-38100804 AACAGATTCAAAAGTCTCACTGG - Intronic
973585462 4:52385804-52385826 TAAATAATCATCATTCTGACTGG + Intergenic
973873890 4:55194934-55194956 AAAAAAATCACCATTCTAACTGG - Intergenic
977032824 4:91908485-91908507 TAGAAAATCATCATTCTAACAGG + Intergenic
977710383 4:100117503-100117525 AACAAAATGTTCATTATCACTGG - Intergenic
978122877 4:105102462-105102484 AAAAGAATAATCATTAACACTGG + Intergenic
978203521 4:106051180-106051202 AACAGAATCATGTCTCTCACTGG + Intronic
978795959 4:112707185-112707207 AACAGAATGGTCTTTCTCCCTGG + Intergenic
980184469 4:129444942-129444964 AACTGAATTCTAATTCTCACAGG + Intergenic
981515963 4:145610289-145610311 AACAGTAGCATCTATCTCACAGG + Intergenic
983913134 4:173262465-173262487 AACATCATCATCAGTCTCATTGG + Intronic
984009863 4:174357675-174357697 AACAGAGTTGTCATTCTCTCAGG - Intergenic
986465372 5:8015922-8015944 TAAAGAATCATCATCCTCAATGG - Intergenic
986984195 5:13481512-13481534 CACATTATCATCATTATCACAGG - Intergenic
987557905 5:19479122-19479144 AACTGAAATGTCATTCTCACAGG + Intronic
988811724 5:34791907-34791929 AACCCCATCGTCATTCTCACTGG + Intronic
989489174 5:42030851-42030873 AAAAAAATCCTCATTGTCACTGG + Intergenic
992052308 5:72952586-72952608 ACCAGAATCATCTTTCTCTTAGG - Intergenic
992111133 5:73495296-73495318 AACACAAGCATCATGCTCAAAGG - Intergenic
994751457 5:103742509-103742531 AGTGGAATCATCATTATCACAGG + Intergenic
994789697 5:104207496-104207518 AACAGAGCCATCTGTCTCACTGG + Intergenic
995849384 5:116529116-116529138 AACAGACTCTTTATTCACACTGG - Intronic
1000226861 5:159270379-159270401 AACAACATCATCATTGTCAGGGG - Exonic
1000315720 5:160088636-160088658 AACTGAGTCTTCATTCTCTCTGG + Intronic
1001877487 5:175214068-175214090 AATAGAAACGTCATACTCACAGG - Intergenic
1003572777 6:7266970-7266992 AACAGACTTATCATTCCCAGGGG + Intergenic
1004004581 6:11627251-11627273 AACAGAATCATAATTGTGCCAGG - Intergenic
1005065704 6:21815591-21815613 AACAGAATCTTCTTTTTCAAAGG - Intergenic
1005204477 6:23385833-23385855 AACAGAAAAATCATTTTCAAAGG - Intergenic
1005717061 6:28559480-28559502 AATAGGATCATGATTCTCAAAGG - Intergenic
1006508929 6:34511307-34511329 ATCAGAATCTGCATTTTCACAGG - Intronic
1007078581 6:39083303-39083325 GACAGATACATCATTGTCACTGG + Intronic
1007284467 6:40737839-40737861 AATAGAATCTTCCTTCTTACAGG + Intergenic
1008540939 6:52546002-52546024 AACAGAATCATCATTCTCACAGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009621230 6:66080297-66080319 AACAGAATTATCATTCAACCCGG - Intergenic
1010946128 6:81975527-81975549 AAAATAATCACCATTCTGACTGG - Intergenic
1011152871 6:84293834-84293856 AAGAGAATCATGGTTCTCAGGGG - Intergenic
1011842106 6:91514239-91514261 AAAAGAAGCATCATCGTCACAGG - Intergenic
1012538934 6:100337395-100337417 TTCAGAATCATCAGTCTCAAAGG + Intergenic
1014363052 6:120505047-120505069 AACAGCTTCATCATTCTAAAAGG + Intergenic
1015063155 6:128992812-128992834 AACAAAATCATCAATGTCAAGGG - Intronic
1016074913 6:139784268-139784290 AACAGAATTATCATTCAACCTGG - Intergenic
1017562988 6:155651641-155651663 AAAAGAATCATCTTTTTTACTGG - Intergenic
1018110853 6:160535661-160535683 ACCACTATCATCATTCTTACTGG - Intronic
1018742096 6:166737570-166737592 AACAGAATGAGCTTTTTCACAGG + Intronic
1024778534 7:52817733-52817755 AAGAGACTCATCATACTCAAGGG + Intergenic
1026618758 7:71931972-71931994 AGCAGTGTCATCATTCACACTGG - Intronic
1027634424 7:80652675-80652697 AACAGAAAAATAATTGTCACAGG + Intronic
1032688943 7:134263222-134263244 AGCAGAAGCAGAATTCTCACTGG - Intronic
1033381034 7:140819407-140819429 AACAGAACCCTCATGCTCAAGGG + Intronic
1034575242 7:151991057-151991079 AACAGTATCATCATGATCGCAGG - Intronic
1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG + Intergenic
1035011587 7:155722226-155722248 AACAGGGTCATCAGTCACACAGG - Intronic
1036436890 8:8743021-8743043 TGCTGAATCCTCATTCTCACTGG - Intergenic
1036734482 8:11298767-11298789 GGCAGATTCATCCTTCTCACAGG - Intronic
1039336750 8:36599817-36599839 AACACAAGCACCATTCTCAGTGG + Intergenic
1039373912 8:37014214-37014236 AAGCGAATCCTCATCCTCACCGG - Intergenic
1041503461 8:58566301-58566323 AACAGATTAGTCATTCTTACAGG - Intronic
1043184870 8:77135274-77135296 AGCAGTATCATCATTATCAGTGG - Intergenic
1044505763 8:93017523-93017545 AACAGTACCATGATTCCCACCGG + Intronic
1047082007 8:121472874-121472896 AAGAGAATAATCTTTCTCAGTGG + Intergenic
1049135492 8:140894321-140894343 AACAGAAACTTATTTCTCACTGG - Intronic
1050575070 9:6986431-6986453 AATGGAATCATCAGCCTCACTGG - Exonic
1050903179 9:10970846-10970868 GACATAATCATCATTTTCACTGG - Intergenic
1050979535 9:11992361-11992383 AATAGAATAATCATTATCAGAGG + Intergenic
1051568837 9:18532068-18532090 ATTAGTATAATCATTCTCACAGG + Intronic
1052431049 9:28367303-28367325 AACACATTCATCATTCTTTCTGG + Intronic
1053150924 9:35742166-35742188 AGCAGAGTGATCTTTCTCACAGG + Intronic
1054104095 9:60979526-60979548 AAAATAATCATCATCCTGACAGG + Intergenic
1054928644 9:70613895-70613917 AACTGAATCAGCATTCTCTCTGG - Intronic
1055165718 9:73190195-73190217 AACAGAATCATCATCTGCACTGG + Intergenic
1058188460 9:101884270-101884292 AAGTGATTCATGATTCTCACAGG - Intergenic
1058585012 9:106498317-106498339 AACAGAATGATCCTTGCCACAGG - Intergenic
1058873075 9:109219085-109219107 AACAGAATCTTCTTTCTTATAGG + Intronic
1060740382 9:126093936-126093958 AACAGAAGCTTCCTTCTCATTGG + Intergenic
1061107261 9:128540950-128540972 TACAGAACCATCAGTCTTACTGG + Intronic
1185840832 X:3389951-3389973 ACCAGAATCTTCATTTTAACAGG - Intergenic
1186117998 X:6325382-6325404 AACAGAAACTTAATTTTCACAGG - Intergenic
1187744783 X:22397060-22397082 ATCAGAATCTTCATTTTAACAGG - Intergenic
1188750693 X:33902338-33902360 AACAGAATGACCATTTACACTGG + Intergenic
1192049523 X:67711292-67711314 AAGAAAATCACCATTCTCCCTGG - Intronic
1192615560 X:72617952-72617974 TACAGGATGAGCATTCTCACTGG - Intronic
1194708623 X:97205617-97205639 TAAATAATCATCATTCTGACTGG - Intronic
1195515407 X:105769367-105769389 AACAAAATTATCTTTCTCAGTGG - Intergenic
1197260155 X:124308782-124308804 AACAGAAGCCTCTTTCTCACAGG - Intronic
1198666440 X:139029066-139029088 GACAGAAATATCAATCTCACAGG + Intronic
1199419454 X:147627390-147627412 AACAAAATCATCACTATCACAGG - Intergenic
1201770963 Y:17616414-17616436 AACATAAACCTCATTTTCACTGG - Intergenic
1201830592 Y:18289572-18289594 AACATAAACCTCATTTTCACTGG + Intergenic