ID: 1008540973

View in Genome Browser
Species Human (GRCh38)
Location 6:52546215-52546237
Sequence TGTGACTCCCTGGGAAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008540973 Original CRISPR TGTGACTCCCTGGGAAAATG AGG Intronic
900828187 1:4943422-4943444 TGTGGGTCCCTGAGAAACTGAGG + Intergenic
902115275 1:14116192-14116214 TGTTAATCCCTGAGACAATGGGG + Intergenic
902933321 1:19746345-19746367 AGTGACTCCCTGGGAGACAGAGG - Intronic
903181341 1:21606372-21606394 TGTGACGCACAGGGAAATTGAGG - Intronic
907682005 1:56573156-56573178 TGTGACTCTTTGGATAAATGAGG - Intronic
908853439 1:68396336-68396358 TGTTACTCCACAGGAAAATGTGG - Intergenic
909096042 1:71290638-71290660 TGTTAATCCCTGAGACAATGGGG + Intergenic
911741134 1:101387569-101387591 TGTTAATCCCTAGGACAATGGGG - Intergenic
912413879 1:109495222-109495244 GGTGCTTCCCTGGGAGAATGAGG - Intronic
916592578 1:166206599-166206621 TCTGCCTCCCTGGGAGAATTTGG + Intergenic
918559482 1:185847489-185847511 TGTGACTGTGTGTGAAAATGAGG - Intronic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
921367203 1:214384597-214384619 TGTCACTCCCAGGGATACTGAGG + Exonic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1062827445 10:582940-582962 TGTTACCTCTTGGGAAAATGGGG + Intronic
1065289921 10:24219735-24219757 TGTGTCTCCTTGGGATATTGCGG - Exonic
1066236962 10:33494402-33494424 TGGGACACCCATGGAAAATGAGG - Intergenic
1067553147 10:47249039-47249061 AGTGGCTCACTGGGAGAATGGGG + Intergenic
1067554386 10:47258130-47258152 TGTGACTGGGTGGGAAAATGGGG + Intergenic
1069638655 10:69941105-69941127 CATGATTCACTGGGAAAATGAGG - Intronic
1070553148 10:77507206-77507228 TGGAACACCATGGGAAAATGAGG + Intronic
1070651800 10:78242955-78242977 TGTGACTCCCCAGGACCATGGGG + Intergenic
1071160863 10:82743623-82743645 TGACAATCCCTGGGAACATGAGG - Intronic
1072237581 10:93466466-93466488 TGCAGCTCCCTTGGAAAATGTGG - Intronic
1072981869 10:100105229-100105251 TTTGACTCACTAGGAAACTGAGG - Intergenic
1074952503 10:118352488-118352510 TGTGTCTCCCTGGCAATAGGTGG + Intergenic
1076385742 10:130053847-130053869 TGTGGGTCCCTGGGAGAGTGGGG + Intergenic
1078652567 11:13209257-13209279 TCTGACTCCCTGGGGCACTGTGG + Intergenic
1079356400 11:19733584-19733606 TGAGACTTCCAGGGGAAATGGGG + Intronic
1079898378 11:26150017-26150039 TCTGCCACCCAGGGAAAATGAGG + Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080071593 11:28095412-28095434 TGTGTCTGCCTAGGACAATGAGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081677689 11:44980585-44980607 TGTGGCTCCCTGAGGGAATGAGG - Intergenic
1082870596 11:57941246-57941268 TGGGAACCCCTGAGAAAATGTGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083339572 11:61950349-61950371 TGGGACTCCCTGGGACTCTGTGG - Exonic
1083949463 11:65946015-65946037 AGTGACTCCCAGGGATGATGGGG + Intronic
1084751145 11:71205080-71205102 TGGGACTCCCTGGGCACTTGGGG - Intronic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1085046548 11:73356893-73356915 TCTGACTCTCTGGGAAGCTGGGG + Intronic
1085305411 11:75482886-75482908 TGTTGCTCCCTGGGGACATGGGG - Intronic
1086138004 11:83462085-83462107 TTCATCTCCCTGGGAAAATGAGG + Exonic
1086176712 11:83900337-83900359 TGTTAATCCCTAAGAAAATGGGG + Intronic
1086461469 11:87009897-87009919 TGTGATTCATTGGGAAAATCAGG + Intergenic
1087979706 11:104596300-104596322 TGAGACTCACTGGGAATCTGTGG - Intergenic
1090201437 11:124860624-124860646 TGTGACTTCATTTGAAAATGAGG + Intergenic
1091862148 12:3795380-3795402 TGTAATTCACTGGGAAAGTGTGG - Intronic
1092132587 12:6123133-6123155 TGTACCTACCTGGCAAAATGAGG + Exonic
1092697643 12:11191165-11191187 TGAGGCTGCCTGGGAAATTGGGG - Intergenic
1093040344 12:14371872-14371894 TGTGACTCCCTTGAAAAACAAGG - Intronic
1093280049 12:17182666-17182688 TGTGCCTCCCTGGGTATTTGGGG + Intergenic
1093415144 12:18911298-18911320 TTTGACTCCCTGGGCAAAGCTGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095916411 12:47484655-47484677 TGTGACTCCAGGAGACAATGGGG - Intergenic
1099136613 12:78911761-78911783 GGTGACACCTTGGGAAAGTGAGG + Intronic
1099504299 12:83453715-83453737 TGTGAATCACAGTGAAAATGAGG + Intergenic
1099946502 12:89250883-89250905 TGTGACTCACTTTTAAAATGAGG + Intergenic
1101353903 12:103958466-103958488 TGTGATTACCTAGGGAAATGAGG - Intronic
1101618371 12:106359765-106359787 TGGGCCTCTCTGGCAAAATGGGG - Intronic
1101639603 12:106578554-106578576 TGTGGGTCCCTGGGAAAAAGGGG + Intronic
1102803721 12:115760756-115760778 TATAACTTCCTGGGAAAGTGGGG + Intergenic
1106224463 13:27774596-27774618 TGAGACTCACTGGGAAGAGGTGG - Intergenic
1107259521 13:38473485-38473507 TGTTACTCCCTGTCAAGATGTGG - Intergenic
1111239612 13:85457433-85457455 TGTTAATCACTGAGAAAATGGGG + Intergenic
1114405594 14:22453152-22453174 TGTGAGTCCCTGGGAGAAAATGG - Intergenic
1116870545 14:50065711-50065733 TGTGACTGTGTGGGGAAATGGGG - Intergenic
1116906322 14:50407051-50407073 TGAGACTCCCTGGGAATTTTAGG + Intronic
1117605418 14:57423641-57423663 TGTTACTCCCTGTAAGAATGAGG - Intergenic
1118919566 14:70137835-70137857 TTTGGCTCCCTGGGAAAAATGGG + Intronic
1120140019 14:80919501-80919523 TGATTATCCCTGGGAAAATGGGG - Intronic
1123630442 15:22257156-22257178 GGCGCCTCCCCGGGAAAATGAGG - Intergenic
1123691514 15:22842221-22842243 TGTGGCTCCCAGTGAACATGTGG - Intronic
1126676062 15:51160175-51160197 TTTTACTCCATGGGAAAAGGAGG - Intergenic
1129909474 15:79214235-79214257 TGTCACTTCCTTGGAAACTGAGG + Intergenic
1130415213 15:83687481-83687503 TAGGACTTCCTGGGAAAAGGTGG + Intronic
1130804946 15:87310152-87310174 TTACACTTCCTGGGAAAATGTGG + Intergenic
1131053392 15:89362313-89362335 TGCGACTCCCAGGGAAAAGCTGG + Intergenic
1132156835 15:99501792-99501814 TGCGCCACCCTGGGAAACTGGGG + Intergenic
1133631812 16:7629158-7629180 TGCTTCTCCCTGGGAAAAAGTGG + Intronic
1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG + Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1136085606 16:27882700-27882722 CCCGACTCCCTGGGCAAATGTGG + Intronic
1137720925 16:50626885-50626907 AGTGTCTCTCTGGGAACATGAGG - Intronic
1138093870 16:54197045-54197067 TATGACTCTCAGGGAAACTGAGG - Intergenic
1143499764 17:7331860-7331882 TTTGAATGACTGGGAAAATGAGG + Intergenic
1144132403 17:12259652-12259674 TGTGACTTCCTTGAAGAATGTGG - Intergenic
1144229974 17:13192180-13192202 TATGACTCCATGGGGAAAGGAGG + Intergenic
1144382921 17:14720563-14720585 TGTGACTGCCTGTGGAGATGGGG - Intergenic
1145091163 17:19987279-19987301 AGCGACTCCATGGTAAAATGAGG + Intergenic
1146739194 17:35266637-35266659 TGTGCCTCCCTGGGGGACTGTGG - Exonic
1149142672 17:53452900-53452922 ATCGACTCCCTGGGAAAATAAGG + Intergenic
1149216869 17:54366423-54366445 TGTGACTCTGAGGGAAATTGTGG + Intergenic
1150651526 17:67013307-67013329 TTTGACTCCGAGTGAAAATGAGG - Intronic
1151226916 17:72654769-72654791 TGTGCCTGCCTGTGAATATGAGG - Intronic
1152309817 17:79543325-79543347 TGTGACTCCCTGATAAACGGAGG + Intergenic
1155277601 18:24203710-24203732 TGTGGCTCTTTGGGAACATGTGG - Intronic
1156070931 18:33207777-33207799 TGTCACTCCTTGTGAATATGTGG - Intronic
1156647907 18:39188922-39188944 TCTGACTCCCTCGCAAAATTTGG - Intergenic
1158388494 18:57022096-57022118 GGATACTCACTGGGAAAATGAGG - Intronic
1158683053 18:59586224-59586246 TGATACTCCCTGGGAAGAAGAGG + Intronic
1160166604 18:76518452-76518474 TGTTTCTCCCAGAGAAAATGTGG - Intergenic
1160429603 18:78802348-78802370 TGAGTCTCCCTGGGGCAATGTGG - Intergenic
1161714262 19:5866548-5866570 GGTGAGGCCCTGGGAAAGTGAGG + Exonic
1161775124 19:6257110-6257132 TGTGACTCCATTGCCAAATGAGG - Intronic
1162192881 19:8960879-8960901 AGTCCCTCCCTGGGAAAGTGTGG + Exonic
1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG + Intronic
1164889121 19:31807906-31807928 TGTTCCTGCATGGGAAAATGAGG + Intergenic
1166393370 19:42422730-42422752 TGTGACACCCTAGAGAAATGAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166472375 19:43089379-43089401 TGTGATTCCATGGGAGAAAGTGG + Intronic
1166496098 19:43304395-43304417 TGGGTCTCCTGGGGAAAATGGGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168093380 19:54100442-54100464 CCTGATTCCCTGGGAAAAGGGGG - Intronic
1168429607 19:56267886-56267908 TTTTACTCCCTGAGAAACTGAGG + Intronic
925263081 2:2545077-2545099 TGTGCCTCCCTATGAAAGTGCGG - Intergenic
925320321 2:2961295-2961317 TGTGACTCCGTGGGATTATGGGG + Intergenic
926309069 2:11661524-11661546 TGTAAGTCTCTGGGAAAATTTGG - Intronic
927897519 2:26793445-26793467 TTTGACTGCCTGGGACAATGTGG + Intronic
928997362 2:37307155-37307177 TTTGACCCCCTGGGAACATTTGG - Intronic
933048472 2:77570803-77570825 GGAGAGTCCCTGGGAAATTGAGG - Intronic
936055283 2:109257838-109257860 TGTGACTCACTGGGAAAGTGGGG - Intronic
937001794 2:118474448-118474470 TGTGAGTCCCTGAGAAATAGGGG - Intergenic
937989341 2:127653724-127653746 TGTGGGTCCCTGGGCAGATGAGG + Intronic
938768770 2:134482148-134482170 TGAGACTGTATGGGAAAATGGGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941697499 2:168569297-168569319 TGTGACTGCCTTGGGAGATGAGG - Intronic
942150603 2:173072862-173072884 TCTGAATCCCTGGGAAATTAAGG - Intergenic
943233386 2:185287278-185287300 TGTGACTCTGTGGAAAAATATGG - Intergenic
947253121 2:228131401-228131423 TTTGATTGGCTGGGAAAATGAGG + Intronic
1169145505 20:3249621-3249643 TTTGACATCCTGGGACAATGAGG + Exonic
1169333359 20:4734125-4734147 TTTGCCTCCCTGGGAATATTTGG + Intronic
1171205218 20:23273842-23273864 TGCCAAGCCCTGGGAAAATGAGG + Intergenic
1172362369 20:34322378-34322400 TGTGACCAGCTGGGAAGATGAGG + Intergenic
1172890626 20:38261092-38261114 TGTGACTCCCTGGGAAGTGTAGG - Intronic
1173498307 20:43534656-43534678 AGTGATGCCCTTGGAAAATGTGG + Intronic
1174414172 20:50356383-50356405 TGGGCCTCCCTGGGAAGATCTGG + Intergenic
1177568000 21:22848211-22848233 TGTCACAACCAGGGAAAATGAGG + Intergenic
1178549079 21:33519949-33519971 TGTCACTCTATGGGAAAATTTGG + Intronic
1180875008 22:19171144-19171166 TGTGAATTACAGGGAAAATGCGG + Intergenic
1182906479 22:33941865-33941887 TGTGCCTCCCTGGGACTCTGTGG - Intergenic
1183335042 22:37241565-37241587 TGTGAGTTCCTGGGGATATGTGG - Exonic
1183662247 22:39228095-39228117 TGTGGCTCTCTGTGATAATGTGG - Intronic
1184695417 22:46136138-46136160 TGTTACTCCCTCGGACAATCAGG - Intergenic
949665264 3:6331700-6331722 TGTTAATCCCTAAGAAAATGGGG + Intergenic
949770408 3:7571180-7571202 TGTTAGTCCCTGAGACAATGGGG - Intronic
949966301 3:9359367-9359389 TATGGCTCCCTGGTATAATGAGG - Intronic
949970389 3:9398158-9398180 TCTCTCTCCCTGGGAAAATGGGG - Intronic
950669938 3:14519970-14519992 TGAGCTTCCCTGGGCAAATGAGG + Intronic
952085073 3:29811133-29811155 TTTCAGTCCCTGGGAACATGAGG + Intronic
952872166 3:37910766-37910788 TGTGTTTCCCTGGGACAAAGAGG - Intronic
952968408 3:38635564-38635586 AGTGATTCCCTGGGCAAAGGAGG - Intronic
954131629 3:48564044-48564066 TGTGACTGTTTGGGAAGATGGGG - Intergenic
958590555 3:96153965-96153987 TGTGACTTCTTGTGAAAGTGGGG - Intergenic
959106939 3:102075741-102075763 TGGGATGGCCTGGGAAAATGTGG - Intergenic
960708089 3:120500705-120500727 TATGAATGCCTGGGAAAAGGAGG - Intergenic
960969673 3:123130507-123130529 TGAGACTCCCTGGGCAGATGAGG + Exonic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964389584 3:156183433-156183455 TGTGACTGCCTGAAAGAATGGGG + Intronic
965992786 3:174840599-174840621 TCTGACTCCCTTGGGCAATGAGG - Intronic
966466319 3:180234173-180234195 TGTTAATCCCTGAGACAATGGGG - Intergenic
968908278 4:3464301-3464323 TGTGACTCCCAGGGAGGGTGTGG + Intronic
969098220 4:4750309-4750331 TGTGACTCCACGGGACAAGGTGG - Intergenic
969802192 4:9577614-9577636 TGTGAATCCCTAAGACAATGGGG + Intergenic
970101998 4:12534469-12534491 AGTGGCTCCCTGGGCAAGTGTGG - Intergenic
970344085 4:15136252-15136274 TGTTAATCCCTGAGACAATGGGG - Intergenic
971962489 4:33507344-33507366 TGTTAATCACTGAGAAAATGGGG + Intergenic
974274467 4:59699907-59699929 GGTCACTCCCAGGTAAAATGAGG + Intergenic
979388441 4:120098473-120098495 TGTGACATCCTGGGACAATAGGG + Intergenic
980096066 4:128492184-128492206 TCTGTCCCCCTGGGAGAATGAGG + Intergenic
980654655 4:135766286-135766308 TGTGAATCACTGGGACAATGAGG - Intergenic
982675448 4:158370193-158370215 TGTTACACCCTGGTAAAATTAGG - Intronic
984550663 4:181155183-181155205 TGTCTCTCCCTGTGAAAATGTGG + Intergenic
986329595 5:6707735-6707757 TGTGTCTCCCAGGGCACATGTGG - Intergenic
987839445 5:23203924-23203946 TATGAGTGCCTGGGAATATGTGG + Intergenic
991303616 5:65152907-65152929 TATAACTACCTGGAAAAATGAGG - Intronic
992317657 5:75574676-75574698 TGTCACTTCTAGGGAAAATGAGG - Intronic
992745114 5:79811716-79811738 TGTTACTATCTGGGAAAACGTGG - Intergenic
993601952 5:89937147-89937169 TGTGACTCCATGTTAACATGTGG - Intergenic
995764850 5:115603409-115603431 AGAGACTCCCAGGAAAAATGAGG - Intronic
996081615 5:119264029-119264051 TCACATTCCCTGGGAAAATGGGG - Intergenic
1001221172 5:169902340-169902362 TGTGGCTCACTGGGAACATGAGG - Intronic
1001421854 5:171593602-171593624 TGTGACTCCCTGCCGAAATGAGG - Intergenic
1002489829 5:179567378-179567400 TGTGTCTCCCTGGCTAAATCAGG + Intronic
1002497467 5:179624826-179624848 AGTGCCACCCTGGGAAGATGCGG + Intronic
1002956341 6:1869083-1869105 TGTCACTCTCTGAGAAGATGAGG + Intronic
1003035406 6:2637127-2637149 TGTGACTCCCTGGGAAGGTGAGG - Intergenic
1003174247 6:3743672-3743694 TCTAACTCCCTGGGAACCTGAGG + Intronic
1007734010 6:43969221-43969243 ACTGAGTCCCTGGGCAAATGAGG - Intergenic
1008540973 6:52546215-52546237 TGTGACTCCCTGGGAAAATGAGG + Intronic
1008885272 6:56425600-56425622 TCTCACTCCGTGGGAAATTGTGG - Intergenic
1009563366 6:65277051-65277073 TGTGACGCCATTAGAAAATGAGG + Intronic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010747229 6:79577883-79577905 ACAGACTACCTGGGAAAATGGGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1018764088 6:166916766-166916788 TGTGTCTCCATGGCAAAATCTGG + Intronic
1020127063 7:5539008-5539030 TGTGAGTCCCGGGGAGGATGAGG - Intronic
1020807614 7:12809606-12809628 TTTGACTCGATGGGGAAATGAGG - Intergenic
1020811019 7:12850315-12850337 TGTATCTCCTTGTGAAAATGTGG + Intergenic
1023736868 7:43243124-43243146 TGTAACTCCCAAGGAAGATGAGG + Intronic
1023954655 7:44874667-44874689 AGTCCCTCCCTGGGAAAATCTGG - Intergenic
1024967805 7:55039731-55039753 TGTGACAGCCCAGGAAAATGTGG - Intronic
1026251872 7:68678359-68678381 TGAGACTCCCTGAGAAACTCAGG - Intergenic
1026534081 7:71225739-71225761 TGTCATTCCCCGGGAAAATTGGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030110038 7:106019175-106019197 TCAGACTCCCTCGGAAAATTGGG - Intronic
1030993985 7:116335675-116335697 TGTGGCTCAGTGGGGAAATGTGG + Intronic
1031649873 7:124275731-124275753 TGTTTCTCCTTGAGAAAATGAGG - Intergenic
1035371390 7:158381131-158381153 TGTGAATCCCTGAGACAATAGGG - Intronic
1035372380 7:158387625-158387647 TGTGAGGCCCTGGGAAGACGCGG + Intronic
1035608605 8:946159-946181 TGTGACTCCCTGGGGGAGTCAGG - Intergenic
1038048126 8:23784340-23784362 TGTGATTGCCTGGTAAAATATGG + Intergenic
1038456648 8:27675927-27675949 TCAGAATCCCTGGGAAACTGGGG - Intronic
1038849977 8:31266242-31266264 TGTGATGCCCTGGGAAAACCAGG - Intergenic
1039135511 8:34319027-34319049 TGTGACTGGCTCGGGAAATGAGG + Intergenic
1040815166 8:51500012-51500034 AGAGGCTCCCTGGGAAAAGGGGG - Intronic
1044716097 8:95101214-95101236 TGTGACTCACTTGGGAACTGAGG - Intronic
1045832685 8:106483029-106483051 TCTGACTCCATAGGAAAATATGG + Intronic
1046400368 8:113697316-113697338 TGTGAATCCCCAAGAAAATGGGG + Intergenic
1047500889 8:125440424-125440446 TGTGACTCCCTGGGGAGGAGAGG - Intergenic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1048880777 8:138870964-138870986 TGAGACTCCCTGGTAAACTCAGG - Intronic
1049559555 8:143302358-143302380 TGTCACTTCCAGGGAAAATGAGG - Intergenic
1049644767 8:143731283-143731305 TCTGACTGCCTGGGAGACTGTGG + Intronic
1049854395 8:144852561-144852583 GTTGACTCCCAGGGAGAATGGGG - Intronic
1051528722 9:18076496-18076518 AGTGCCTCCATGGGATAATGAGG + Intergenic
1051879981 9:21830007-21830029 TGTGACTGCCCTGGAAAAAGAGG + Intronic
1052746127 9:32442827-32442849 ACTGACTCCCTGGGTAAAGGGGG + Intronic
1054811897 9:69441705-69441727 TGTGCCTCCTTGGGAGAATGGGG + Intronic
1055411720 9:76037630-76037652 TGTGAGTCCCTCTGGAAATGTGG + Intronic
1056254278 9:84782701-84782723 CGTCACTGCCTCGGAAAATGTGG - Intronic
1057984015 9:99691010-99691032 TGTGTTTCCAAGGGAAAATGGGG - Intergenic
1058269471 9:102952091-102952113 TGTTATTCCCTTTGAAAATGAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059210153 9:112506565-112506587 TGTGACTACCTGGGTACTTGGGG + Intronic
1061014313 9:127973097-127973119 TGGGGCTCCCTGGTAAGATGAGG + Intronic
1062132908 9:134909702-134909724 TGTGTCTGGCTGGGGAAATGGGG + Exonic
1062324023 9:136004005-136004027 TGGGGCTCCCTGGGGAACTGTGG - Intergenic
1186740320 X:12510534-12510556 TGTGGCTCTGTGGGAGAATGAGG - Intronic
1187003257 X:15204431-15204453 TGTAACTCATTGTGAAAATGAGG - Intergenic
1188069540 X:25702144-25702166 TGTTACTCCAAGAGAAAATGTGG - Intergenic
1188292316 X:28405021-28405043 TGTGACTGGCTGTGAGAATGGGG - Intergenic
1189647361 X:43148035-43148057 TCTCTCTCCCTGGGAAAAGGAGG - Intergenic
1189864256 X:45307869-45307891 TGTGACTGGCAGGGAAAATGAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192219480 X:69187697-69187719 TGTGTCTCCCTGAGAATGTGAGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194160354 X:90441723-90441745 TGTGACACCCTGGGAGAACCAGG - Intergenic
1194323227 X:92477951-92477973 TGTTCCTCCCTGGAAACATGGGG - Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194607764 X:96002884-96002906 TGTGACAAACTGGAAAAATGAGG + Intergenic
1200206743 X:154321774-154321796 AGGGACTCCCTGGGAGAATGAGG + Intronic
1200506645 Y:4018671-4018693 TGTGACACCCTGGGAGAACCAGG - Intergenic
1200631327 Y:5591111-5591133 TGTTCCTCCCTGGAAACATGGGG - Intronic
1201020091 Y:9647326-9647348 TGTGACTGCCAGGGAGAAAGAGG - Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic