ID: 1008541103

View in Genome Browser
Species Human (GRCh38)
Location 6:52547046-52547068
Sequence TGTATGGGTGAGCATGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008541096_1008541103 11 Left 1008541096 6:52547012-52547034 CCAAAGCTGGAGGAAAGGAGGGG 0: 1
1: 0
2: 1
3: 57
4: 383
Right 1008541103 6:52547046-52547068 TGTATGGGTGAGCATGGAGTGGG 0: 1
1: 0
2: 2
3: 22
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008541103 Original CRISPR TGTATGGGTGAGCATGGAGT GGG Intronic
900735778 1:4298621-4298643 TTTGCGGCTGAGCATGGAGTGGG + Intergenic
901332042 1:8417709-8417731 TGTATGGGTGAGTGTGGGGATGG - Intronic
901924781 1:12559306-12559328 TGTCTGGGTGATCATGTAGACGG + Intergenic
903187932 1:21639855-21639877 TCTGTGGGTGAGAATGGAGATGG + Intronic
903419694 1:23209781-23209803 TGGATGGTGGAGCATGGAGTCGG - Intergenic
903811290 1:26036341-26036363 GGTATAGGTGAGAATGGAGTTGG + Exonic
905103501 1:35546216-35546238 TGTAAGGGAGAGAAGGGAGTGGG + Intronic
910446662 1:87305216-87305238 TGTTTGGCTGAGCATGGTGGTGG - Intergenic
911105638 1:94129350-94129372 TGTCTGGGTGAGAAGGGAGGGGG - Intergenic
916990577 1:170239643-170239665 TGTATGGGTGGGGAGGGAGGAGG + Intergenic
917874466 1:179273298-179273320 TGTATGTGGGAGAATGAAGTGGG + Intergenic
920335856 1:205244708-205244730 TGTAAGGGTGACAAAGGAGTTGG + Intronic
922791017 1:228311127-228311149 TGTATGGAGCAGCATGGAGCTGG + Intronic
922991149 1:229912737-229912759 GGAATGGGAGAGCATGGAGTGGG + Intergenic
923082161 1:230668321-230668343 TGAATGGGAGAGCTTGGAGTCGG + Intronic
1063284544 10:4671217-4671239 TTTATGAGTGGGCATGGATTTGG + Intergenic
1063609053 10:7547740-7547762 TGTATGGGAGAGGGAGGAGTGGG - Intergenic
1064992471 10:21268035-21268057 TTTATGAATGAGCATGCAGTTGG - Intergenic
1065221387 10:23499555-23499577 TGTCTGGGTGAGCATGGGGGTGG + Intergenic
1065768831 10:29057541-29057563 TGTGTGTGTGTGTATGGAGTGGG - Intergenic
1067259914 10:44680419-44680441 TGTATGTGTGTGCATGGGGCAGG - Intergenic
1070770051 10:79077035-79077057 TGTATGGGGAAGCAGGGAGGTGG + Intronic
1075497652 10:122939808-122939830 AGTATGGGTGAACATTAAGTAGG + Intronic
1075719671 10:124577322-124577344 TGTATGGGTGGGCCAGGGGTGGG - Intronic
1075823675 10:125335434-125335456 TGAATGCTTGAGCATGGAGTTGG + Intergenic
1079619415 11:22535081-22535103 TGGATGGGTGAAAATGGAGATGG - Intergenic
1080427597 11:32170451-32170473 TGTATGGCTGAAAATGGAGAGGG + Intergenic
1084518629 11:69649737-69649759 TGCATGTGTGACCCTGGAGTGGG + Intronic
1085440170 11:76554396-76554418 TGTATGTGTGAGCATGGAAGAGG - Intergenic
1086535719 11:87842756-87842778 TGTATGTGTGCGCATGGGGTGGG - Intergenic
1087693716 11:101351652-101351674 GGTAGGGTTGGGCATGGAGTGGG + Intergenic
1088539131 11:110894869-110894891 TGTATTTGTGTGCATGGGGTGGG + Intergenic
1091001503 11:131913690-131913712 TGTTTGGGTGTGGATGGAGATGG + Intronic
1091621578 12:2093206-2093228 TGTGTGGGTGACTATGCAGTGGG + Intronic
1095706680 12:45244429-45244451 TGCATGGGTGGGCCTGGAGGAGG + Intronic
1098790675 12:74817671-74817693 TGTGTGGGTGAGCAAGGATGGGG - Intergenic
1100809299 12:98322896-98322918 TGTATGTGTGGGCATTGAGTGGG - Intergenic
1101004930 12:100392389-100392411 TGTATGTATGAGTATGGACTGGG + Intronic
1101625519 12:106436893-106436915 TGTATGGATGAGCATGGTGTAGG - Intronic
1101978857 12:109387875-109387897 TGGATGGGAGACCATGGAGGGGG - Intronic
1102396867 12:112593457-112593479 TGTATCGGTCAGGATGGACTAGG - Intronic
1102662318 12:114540064-114540086 TGTTGGGTTGAGCATGGAGGGGG + Intergenic
1102665409 12:114568242-114568264 TGTTGGGTTGAGCATGGAGGGGG - Intergenic
1104262541 12:127197636-127197658 AGAATAGGTGAGCAAGGAGTAGG - Intergenic
1106853327 13:33818654-33818676 TGTATGTGTTGGGATGGAGTTGG + Intronic
1107113129 13:36719153-36719175 TGTATGGGAGAGCACGCACTGGG - Intergenic
1112388924 13:98964959-98964981 TGTATGGGTGAAGGTGGAGCAGG - Intronic
1112487585 13:99834082-99834104 GGCATGGCTGAGCATGCAGTGGG + Intronic
1112585582 13:100716047-100716069 TTTATGGGTGATCATAGAGGAGG - Intergenic
1114517470 14:23309055-23309077 TGGATGGGTGGGCATGGAACAGG + Exonic
1115863375 14:37714310-37714332 TGTATGTGTGAGCTTGGAATGGG + Intronic
1116085433 14:40231268-40231290 TTTATGGGTGAGCTTGGAAAAGG + Intergenic
1117055842 14:51911256-51911278 TGTATGTGTGTGCTTGGGGTGGG + Intronic
1121848695 14:97198714-97198736 TGTATTGGTCAGGATGGACTAGG + Intergenic
1123781491 15:23633200-23633222 GGTATGGGGAAGGATGGAGTTGG + Intergenic
1125766606 15:42140749-42140771 TGTGTGAGAGAGCATGGAGCAGG + Exonic
1130138025 15:81197863-81197885 TGTATGGCTCAGCCTGAAGTGGG - Intronic
1130547788 15:84869225-84869247 GGTATTGGTGGGCAGGGAGTGGG - Exonic
1130790081 15:87144965-87144987 TGTTTGGATAGGCATGGAGTGGG - Intergenic
1130869911 15:87962367-87962389 TCTAGGGGTGAGCATGGATGGGG - Intronic
1131639249 15:94272302-94272324 TGTGTGGGTGTGCATGCATTGGG + Intronic
1131639371 15:94273746-94273768 TGTGTGGGTGTGCATGCATTGGG - Intronic
1132237858 15:100235389-100235411 CGTATGTGTGTGCATGGTGTGGG - Intronic
1132911821 16:2317632-2317654 TGTCAAGGTGAGCATGGCGTCGG - Exonic
1133437142 16:5789464-5789486 TGTATGGGTGTGTATGTATTTGG + Intergenic
1134271381 16:12736090-12736112 TGTAAGGGTGAGCAGGGCATGGG + Intronic
1135134351 16:19876593-19876615 TGCATGGCTGAGCAGGAAGTGGG - Intronic
1135903649 16:26490253-26490275 AGTATGGGAGAGAATGGAATAGG - Intergenic
1135906486 16:26516810-26516832 TGTATGAGTGAGTGTGGGGTGGG + Intergenic
1139371165 16:66470257-66470279 TGGATGGGTGAGAAGGGAGAAGG + Intronic
1141344369 16:83231607-83231629 TGAGTGGGTGAAAATGGAGTGGG - Intronic
1141704416 16:85656792-85656814 GGTGTGGCTGAACATGGAGTAGG + Intronic
1142294363 16:89210777-89210799 TGTAAGGGTGAGCCTGGGGCAGG - Intergenic
1146353309 17:32113878-32113900 TGCATGGGTGTGCATGAATTTGG + Intergenic
1146667101 17:34712546-34712568 AATGTGGGTGAGGATGGAGTAGG - Intergenic
1148172472 17:45534220-45534242 TGTATGGAGGAGCTTGGTGTGGG - Intergenic
1148197048 17:45721603-45721625 TGTATGGGAGGGCATTGATTTGG - Intergenic
1148276797 17:46311233-46311255 TGTATGGAGGAGCTTGGTGTGGG + Intronic
1148298914 17:46528817-46528839 TGTATGGAGGAGCTTGGTGTGGG + Intronic
1148363449 17:47033339-47033361 TGTATGGAGGAGCTTGGTGTGGG + Intronic
1148834996 17:50461322-50461344 TGCATGGGTGCTCATGCAGTTGG + Exonic
1149445326 17:56708742-56708764 TATATCGGTGAGCATGGTGTGGG + Intergenic
1150403678 17:64881136-64881158 TGTATGGAGGAGCTTGGTGTGGG - Intronic
1150757143 17:67924721-67924743 TGCATGGGTGTGCATGAATTTGG - Intronic
1153796990 18:8632672-8632694 TGTGTGTGTGAGCGGGGAGTGGG + Intronic
1155840482 18:30636569-30636591 TGTATGGTGGAGGAGGGAGTAGG - Intergenic
1156811623 18:41259937-41259959 AGTATGTGCTAGCATGGAGTTGG - Intergenic
1158565587 18:58551600-58551622 TAAATGGGAGACCATGGAGTGGG - Intronic
1158707940 18:59810785-59810807 TGTATGTGTGAGATTGGAGGTGG - Intergenic
1160751805 19:737916-737938 GGCGTGGGTGAGCACGGAGTCGG - Intronic
1161456230 19:4370958-4370980 GGGATGCGTGAGCATAGAGTGGG - Intronic
1163084746 19:14971386-14971408 GGTATGGATGTGCAGGGAGTGGG - Intronic
1166109133 19:40612012-40612034 TGGATGGGTGAGGGGGGAGTTGG + Intronic
1168467917 19:56618915-56618937 TGCAGGGGTGAGAATGGGGTGGG + Intronic
929313405 2:40451306-40451328 TGTAGGGGGTAGCAGGGAGTGGG - Intronic
929483631 2:42336201-42336223 TCTATGGCTGAGCATGGAGTTGG - Intronic
929602484 2:43213033-43213055 TGTCTGGGTGAGCGTGGGGCAGG + Intergenic
930756889 2:54984123-54984145 TGTATGGGTGAGATTTGAGATGG - Intronic
931832289 2:66065284-66065306 TTAATGGGTTATCATGGAGTGGG - Intergenic
937621225 2:123989854-123989876 TGAATGGGTGAACATGCTGTGGG + Intergenic
939071590 2:137550745-137550767 TGGATGGTTTAGCTTGGAGTAGG + Intronic
942061760 2:172234317-172234339 TGTAGGGGTGAGAAGGGAGTGGG + Intergenic
942434484 2:175956881-175956903 TGTAGGTGCCAGCATGGAGTAGG - Intronic
942542474 2:177028812-177028834 TGGAGGGGTGATCATGGATTAGG - Intergenic
943524236 2:188996664-188996686 TGTATGTGTGTGTATGGAGCAGG + Intronic
945299130 2:208199688-208199710 TGTTTCAGAGAGCATGGAGTTGG - Intergenic
945666349 2:212748439-212748461 TGTATTGGTTAGCATGCATTTGG - Intergenic
946039386 2:216770759-216770781 TGTGAGGGTGAGGAAGGAGTTGG + Intergenic
946570299 2:221017295-221017317 TGTATGAGTGAGCATGGAAGTGG - Intergenic
1172788285 20:37484932-37484954 TGTGAGGGAGAGCATGGGGTAGG + Intergenic
1172842755 20:37911921-37911943 TGTGCGGGTGAGGATGGAGCTGG + Intronic
1173622570 20:44448079-44448101 TGTATGGGTTGGTATAGAGTTGG + Intergenic
1173738502 20:45378660-45378682 TGAATGGATGAGCATGGTTTGGG - Intronic
1175314571 20:58038523-58038545 TGAGTGGGAGAGCATGGAGGAGG - Intergenic
1175390368 20:58623316-58623338 TGTATGAGGGTGCATGGAGGTGG + Intergenic
1175955144 20:62605244-62605266 TGTCTGTGTGTGCATGGAGGTGG - Intergenic
1179356243 21:40663205-40663227 TGTATGTCTGTGCATGGTGTGGG + Intronic
1180182517 21:46124314-46124336 TGGATGGGTGGGCGTGGAGTTGG + Intronic
1181547855 22:23613427-23613449 TGTATGAAGCAGCATGGAGTGGG - Intronic
1181922462 22:26331162-26331184 TGTATGCCTAAGCATGGAATGGG - Intronic
1182051006 22:27312723-27312745 TGTATGTGTGTGCCTTGAGTAGG - Intergenic
949855397 3:8456769-8456791 TGACTGGGTGAGCTTGGAGCTGG - Intergenic
952205833 3:31181073-31181095 TGTGGGGGTTAGCATGGAGAGGG + Intergenic
954459820 3:50619923-50619945 TTTATGGGTGAGCATGGCTAAGG + Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
956057972 3:65320918-65320940 TATATGGGTGAGCTTGGAAGTGG - Intergenic
956369188 3:68539674-68539696 TGTGTGGGGGGGCATGGGGTGGG + Intronic
956977801 3:74601994-74602016 TTTATGGGTCAGCTGGGAGTTGG - Intergenic
960237277 3:115298327-115298349 TTAATGGGTTACCATGGAGTGGG - Intergenic
960359794 3:116697611-116697633 GGGATGGATGAGGATGGAGTGGG + Intronic
960506124 3:118496607-118496629 TGTATGGGTGAGTATGGGTTGGG - Intergenic
964063949 3:152558787-152558809 TCTAGGGGTGAGCAAGAAGTAGG + Intergenic
965490745 3:169332875-169332897 TGCATGGGTTAGCATAGACTTGG - Intronic
967090502 3:186130782-186130804 TGTTTGGAGGAGCATGGATTTGG + Intronic
968563122 4:1295550-1295572 GGCATGGGCGAGCATGAAGTAGG - Intronic
968613819 4:1568613-1568635 TGCATGGGAGAGGGTGGAGTTGG - Intergenic
969561589 4:7951520-7951542 TGTCTGGGTCAGCTTGGAGCTGG + Intergenic
972784385 4:42313579-42313601 TGAATGAGTGAGGGTGGAGTAGG - Intergenic
973858268 4:55035099-55035121 TGGAAGGGTGAGAAGGGAGTGGG - Intergenic
975642531 4:76514490-76514512 GGTATAGGGGAGAATGGAGTAGG + Intronic
976099476 4:81545598-81545620 TGTTTGGGTGAGCAGTGAATTGG - Intronic
977865820 4:102026245-102026267 TGTAAGAGTGAGCCTGGAGCTGG - Intronic
979008341 4:115333963-115333985 TTTGTGGGTGAGCAAGGGGTGGG - Intergenic
979847686 4:125536796-125536818 TGTAAGGGTGTGCATGGAAGTGG + Intergenic
980463214 4:133145588-133145610 TTTATGGGTAAGCATGAAATAGG - Intergenic
980924849 4:139125721-139125743 TGTCTGGATGAGTATGGAGTGGG + Intronic
981213938 4:142140388-142140410 TGAATGGGTGAACATAGAGCTGG + Intronic
984125055 4:175798003-175798025 TGATTCGGTGAGTATGGAGTGGG - Intronic
985949391 5:3211713-3211735 TGTATGGGTGTGCATGCATGTGG + Intergenic
985966120 5:3339957-3339979 AGCATGGGTAAGCATTGAGTGGG - Intergenic
986309867 5:6543969-6543991 TGTGTGTGTAAACATGGAGTGGG - Intergenic
986686750 5:10281617-10281639 TTTGTGGGTTAGCATGGAGGTGG + Intronic
986888822 5:12275030-12275052 TGTATTGGTGAGCCTGGGGTAGG - Intergenic
990845594 5:60134926-60134948 TCTATGTGTGTGTATGGAGTGGG - Intronic
991411283 5:66347953-66347975 TGTATGGATGAGGCTGGAGAAGG - Intergenic
992380283 5:76229533-76229555 TGTACAGGTGAGCATGAAGGTGG - Intronic
992671256 5:79063188-79063210 TGTCTGGGTGAGCCTGGATATGG - Intronic
992773725 5:80071985-80072007 TGTATGGCTGACCCTGGAGAGGG - Intronic
993547342 5:89229542-89229564 TATATGGCTGAGCCTGGAGCCGG + Intergenic
995254960 5:110035539-110035561 TGTATGTGTGTGCATGTGGTAGG + Intergenic
995733586 5:115273163-115273185 TGTTTGGGTGGGCAAGGAGGAGG + Intronic
996254284 5:121379079-121379101 TGTGGGGCTGAGCATAGAGTTGG - Intergenic
997211081 5:132077150-132077172 TTTCTGCATGAGCATGGAGTGGG - Intergenic
997458858 5:134038557-134038579 TGTATGGGACAGCATGGGGCAGG + Intergenic
1000148538 5:158476958-158476980 AGTATGGCTGAGCCTGCAGTGGG + Intergenic
1001179998 5:169511580-169511602 TGTATGTGTGTGTGTGGAGTGGG - Intergenic
1003394684 6:5742991-5743013 TGTTTGTGTGAGGGTGGAGTGGG + Intronic
1003399080 6:5776665-5776687 TGAATGGCTCAGCAAGGAGTAGG + Intergenic
1004389941 6:15201695-15201717 TGAATGGCTGAGCAAGGAGGTGG - Intergenic
1006403568 6:33831531-33831553 TCTATGGGTGGGCAGGGAGCTGG - Intergenic
1006523457 6:34585490-34585512 TGCTTTGGGGAGCATGGAGTAGG - Intergenic
1008541103 6:52547046-52547068 TGTATGGGTGAGCATGGAGTGGG + Intronic
1008666284 6:53720233-53720255 TGGAAGGGTGAGAAGGGAGTAGG - Intergenic
1008682485 6:53887848-53887870 GGCATGGGAGAGCATGCAGTGGG + Intronic
1013645884 6:112140748-112140770 TGTATGGCTGACCTTGAAGTTGG + Exonic
1016737584 6:147495775-147495797 TGTATAGGTCAGCATTGAGGAGG - Intergenic
1017824074 6:158068877-158068899 TGCATGTGTGAGCATAGAGAAGG - Intronic
1019125906 6:169840035-169840057 GGTGTGGGTGGGCGTGGAGTGGG - Intergenic
1020950086 7:14664528-14664550 TGTAAGGGTGAGGCTGGAGAGGG - Intronic
1021299439 7:18954701-18954723 TGTATGTGTGTGAAGGGAGTTGG - Intronic
1022466698 7:30656885-30656907 TGCATGTGTGAGCATGGATCTGG + Intronic
1024013970 7:45294441-45294463 TGTGTGTGTGAGCCTGGAGCTGG + Intergenic
1024033392 7:45484301-45484323 TGCAGGGGTGAGCAGGCAGTGGG - Intergenic
1026969584 7:74459871-74459893 TGTGTGGCTGACCCTGGAGTTGG + Intronic
1028332899 7:89618763-89618785 TGTGTGTGTGTGTATGGAGTGGG - Intergenic
1031826302 7:126570324-126570346 TGCATAAGTGAGCATGAAGTGGG + Intronic
1032746060 7:134787523-134787545 TGTAGGGGTGAGGGTGGAGGTGG - Intronic
1034570282 7:151950274-151950296 TGGAAGGGTGTGCAAGGAGTGGG - Intergenic
1034779068 7:153860449-153860471 GGAATGGGTGGGCAGGGAGTTGG - Intergenic
1034897077 7:154883220-154883242 TGAATGTGTGAGCATTGTGTGGG - Intronic
1035482458 7:159198249-159198271 AGCATGGCTGAGCATGGAGACGG + Intergenic
1038279520 8:26151337-26151359 TGTATTTTTGAGGATGGAGTTGG + Intergenic
1038287729 8:26220683-26220705 TGTTTGTGTGTGCATGGAGTGGG + Intergenic
1039057814 8:33550566-33550588 TGTATGGGTGGGAGTGGGGTGGG + Intronic
1040021715 8:42746799-42746821 TGTGGTGGTGAGCCTGGAGTTGG - Intergenic
1040479465 8:47810594-47810616 CATATGGGTCAGCATAGAGTTGG - Intronic
1040826082 8:51622247-51622269 TGCCTGAGTGAGCCTGGAGTAGG + Intronic
1042103724 8:65301492-65301514 TGTCTGTGTGTGCATGGAGTGGG - Intergenic
1047199416 8:122752349-122752371 TGTGTGGTTGGGAATGGAGTGGG - Intergenic
1047566154 8:126046615-126046637 TATCTGCCTGAGCATGGAGTAGG + Intergenic
1047738125 8:127784448-127784470 TGGAGGAGTGAGCATGGGGTGGG - Intergenic
1048071878 8:131029851-131029873 TGTGTGGGTGGGGGTGGAGTAGG + Intronic
1049353504 8:142176690-142176712 TTTATGGGTGTGCAGGGAGTGGG - Intergenic
1049426932 8:142541884-142541906 TGTGGGGGTGAGGATGGCGTAGG - Intronic
1052957338 9:34263578-34263600 TGCATGTGTGAGCAGGGAGTGGG - Intronic
1055531769 9:77191790-77191812 TTTATGGTTGAGCATGTGGTTGG + Intronic
1056005047 9:82260730-82260752 TGTGTTGGTGAGCAGGGAGGAGG + Intergenic
1057270764 9:93649769-93649791 TCTATGGGTGAGCATGTCATGGG - Intronic
1057405719 9:94769037-94769059 TGGATGGGTAAGCAGGGAATTGG + Intronic
1059426833 9:114226555-114226577 TGTATGTGACAGCATGGACTGGG + Intronic
1185760378 X:2686115-2686137 TGTATGTGTGTGCATGCAGATGG + Intergenic
1186991268 X:15071101-15071123 TGTGTTGGTGAGAATGGGGTGGG + Intergenic
1187005809 X:15231808-15231830 TGCATGGGAGCCCATGGAGTGGG + Intergenic
1187191574 X:17040522-17040544 TTTATGGGATAGCATGGGGTAGG + Intronic
1187288289 X:17927417-17927439 TGTATAGGTGAGCGGGGAGGAGG - Intergenic
1187317406 X:18208785-18208807 TGTATGTGTGTGCATGGATTGGG + Intronic
1189025539 X:37389811-37389833 TGTAGGGGTGAGAATAGACTGGG + Intronic
1189724988 X:43959337-43959359 TGGGTGGGTGAGTATGGACTTGG - Intronic
1192788111 X:74354294-74354316 TGTAGGGGTCAGCCTGGTGTTGG - Intergenic
1193085365 X:77444129-77444151 GGTATGTGTGGGCATGGGGTGGG + Intergenic
1193505758 X:82341436-82341458 TCTATGTGTAAGCATGTAGTGGG - Intergenic
1194853703 X:98902153-98902175 TGTATGAGGGAGCATTGAGCAGG + Intergenic
1195726559 X:107923658-107923680 AGTAAGGGTAAGGATGGAGTAGG + Intronic
1198085068 X:133274912-133274934 TGTAGGTCTGAGCCTGGAGTTGG - Intergenic
1199137589 X:144271260-144271282 TGTATGTGTGACCATGGTATTGG + Intergenic
1199421228 X:147646983-147647005 TTTATGGGCTAGCATGCAGTAGG - Intergenic
1199897623 X:152138695-152138717 GGTACGGGTGAGGATGGGGTTGG + Intergenic
1200223674 X:154404812-154404834 TCTATCGGTGAGCACGGAGCTGG - Exonic
1201964476 Y:19716576-19716598 TGGGTGAGTGAGCATGCAGTGGG - Exonic