ID: 1008542612

View in Genome Browser
Species Human (GRCh38)
Location 6:52558274-52558296
Sequence CTGCTCCCACCTGGTGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008542612_1008542626 28 Left 1008542612 6:52558274-52558296 CCGGGAGCACCAGGTGGGAGCAG No data
Right 1008542626 6:52558325-52558347 TAAGGAGTACCTCACCACTCTGG No data
1008542612_1008542619 10 Left 1008542612 6:52558274-52558296 CCGGGAGCACCAGGTGGGAGCAG No data
Right 1008542619 6:52558307-52558329 CCCCCACGTCCAGTCCCATAAGG 0: 1
1: 0
2: 0
3: 16
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008542612 Original CRISPR CTGCTCCCACCTGGTGCTCC CGG (reversed) Intronic