ID: 1008542667

View in Genome Browser
Species Human (GRCh38)
Location 6:52558787-52558809
Sequence CACATGGAAAAGCCTAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008542667_1008542672 26 Left 1008542667 6:52558787-52558809 CCTCTATTAGGCTTTTCCATGTG 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1008542672 6:52558836-52558858 TGTGTCAGTGGCTAGAGATGTGG No data
1008542667_1008542671 14 Left 1008542667 6:52558787-52558809 CCTCTATTAGGCTTTTCCATGTG 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1008542671 6:52558824-52558846 GATTCAGAAAAATGTGTCAGTGG 0: 1
1: 0
2: 2
3: 18
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008542667 Original CRISPR CACATGGAAAAGCCTAATAG AGG (reversed) Intronic
902088073 1:13878438-13878460 GACTTGGAAGAGCCTAAGAGAGG + Intergenic
902533345 1:17104731-17104753 CACATTGAAAAGGCAAAAAGAGG - Intronic
907589379 1:55651710-55651732 CTCAGGGATAAGCCCAATAGGGG + Intergenic
913175680 1:116270936-116270958 CACATAGAGATGCCTAATAATGG - Intergenic
913184980 1:116362720-116362742 CACATGGAAAATCCTAAAACTGG - Intergenic
915039317 1:152954623-152954645 ATCATGGAAAACCCTAAAAGAGG + Intergenic
918236662 1:182586828-182586850 CTCAAGGAAAAGGCTAAAAGTGG - Exonic
918967154 1:191366039-191366061 CACATGGAAAAGAATAAAACTGG - Intergenic
919416773 1:197320342-197320364 CACACTGAATAGCCTAATAAAGG - Intronic
919487436 1:198161663-198161685 AACATGGATAAACCTAAAAGAGG - Intronic
921061355 1:211587685-211587707 CACATGGAAAGGGCTTATAATGG + Intergenic
921762224 1:218929510-218929532 TACCTGGAAAAGACTCATAGAGG + Intergenic
922114590 1:222600316-222600338 TACATGGAAAAGCCAAACTGTGG + Intergenic
1065223077 10:23515723-23515745 CAACTGGAAAAGACTTATAGTGG + Intergenic
1065674950 10:28164407-28164429 CACCAAGAAAAGCCTAATAGTGG - Intronic
1066429844 10:35341110-35341132 CACAAGTAAAAGCCTTACAGTGG + Intronic
1070067877 10:73055988-73056010 TAAATGGCAAAACCTAATAGTGG + Intronic
1071626765 10:87179699-87179721 CATAGTGAAAAGCCAAATAGGGG - Intronic
1072569253 10:96644005-96644027 CACATGAATAAGCCTCTTAGAGG + Intronic
1072878582 10:99202294-99202316 AACATTTAAAAGCCAAATAGGGG - Intronic
1075221841 10:120591830-120591852 TACATGGAAAATCCTAATACTGG + Intergenic
1078825440 11:14925566-14925588 CACAAGGAAAAGCCTAATTAGGG + Intronic
1082962074 11:58927923-58927945 CACACGGAAAAGCCTAAAAAGGG - Intronic
1083381571 11:62273717-62273739 GACATTGAAAATCTTAATAGGGG - Intergenic
1086093962 11:83031890-83031912 CACATGGTCAAGACAAATAGAGG - Intronic
1086747426 11:90447021-90447043 CACAACAAAAAGCCTTATAGTGG - Intergenic
1087469486 11:98553170-98553192 AACATGGAAAAGCATAGTATAGG - Intergenic
1087666225 11:101052357-101052379 ACCATGGAACAGCCTAAAAGAGG - Intronic
1089777506 11:120848575-120848597 CAAATAGAACAGCCTAATATTGG - Intronic
1090537050 11:127654270-127654292 AACATGGAAAAGACTAAAAAAGG - Intergenic
1091171256 11:133521563-133521585 AACATGCAAAATCCTGATAGTGG + Intronic
1091953225 12:4613016-4613038 AAAATGGAAAATCCTAATAAGGG - Intronic
1093007959 12:14071414-14071436 CACATGGAGAAGCCATATACAGG + Intergenic
1093806811 12:23444055-23444077 CACATGTAAAAGAGTAATATTGG + Intergenic
1095221220 12:39618737-39618759 CACATAGAAAAGGCTATTTGCGG - Exonic
1100771442 12:97927273-97927295 CACATTGGAAAGTCAAATAGTGG + Intergenic
1102053352 12:109879291-109879313 CACATGGAGAAGGAGAATAGAGG + Intronic
1107827231 13:44339425-44339447 CACATGGAAAAGCCAAACCCTGG + Intergenic
1110102773 13:71630943-71630965 CACAGGTAGAAGGCTAATAGTGG + Intronic
1110391776 13:74982889-74982911 CACATGGAAAAGCCACACATAGG - Intergenic
1111325234 13:86685641-86685663 CACCTGAAAAATCCTAATTGAGG + Intergenic
1112585661 13:100716421-100716443 GACAGGGAAAAGCCTAGAAGGGG - Intergenic
1112960789 13:105123308-105123330 CACATGGAAAAGAATCACAGAGG + Intergenic
1116699079 14:48215415-48215437 CACATGGGAAAGAGTAAGAGAGG - Intergenic
1117591252 14:57270242-57270264 CACAGGGCAAATTCTAATAGTGG - Intronic
1118933856 14:70267662-70267684 CACATGGTCAAGCCTATTAATGG + Intergenic
1120861014 14:89254995-89255017 CACATGGGAAATCCTCATGGGGG - Intronic
1122166307 14:99826928-99826950 CACATGGAGAAGACTATTTGAGG + Intronic
1123143032 14:106100013-106100035 CACATGGAAAAGAATAAAACTGG - Intergenic
1124411799 15:29443222-29443244 CACATGTAAAAGCCAAAAGGAGG + Intronic
1127112158 15:55686251-55686273 CACATGGAAAAGGTGAATATGGG - Intronic
1127984061 15:64055012-64055034 CACAGGGAAAAGCAAAACAGAGG + Intronic
1128918128 15:71586177-71586199 CAGATGGAAAAGACTAGAAGAGG - Intronic
1129866615 15:78913938-78913960 CACATGGAAAACACTATGAGAGG - Intergenic
1131220196 15:90577246-90577268 CAGATGGAAAGAGCTAATAGAGG + Intronic
1131972897 15:97910192-97910214 CACATGGAAGAGGATAATAAAGG + Intergenic
1132610269 16:812482-812504 CACATGAAAAAACATAATTGTGG + Intronic
1133776127 16:8896656-8896678 CCCATAGAAAAGCCAAACAGAGG - Intronic
1136082379 16:27860606-27860628 CACAGGGAAAAGACTATTGGTGG + Intronic
1138059121 16:53870651-53870673 CACATGAAAAAGCACAAAAGAGG - Intronic
1138103046 16:54269744-54269766 CACATGGAAAAGCTGAACAAAGG + Intronic
1139987023 16:70907152-70907174 CATATGGGAAAGCCTAGGAGAGG - Intronic
1141324985 16:83048501-83048523 TAAATGGAAAAGCCTTAGAGTGG - Intronic
1143276494 17:5715207-5715229 CACATGGGGAAGCCAAGTAGAGG - Intergenic
1143663496 17:8342126-8342148 CACATGGATCAACCTAATAATGG + Intronic
1144133324 17:12268565-12268587 CACATGGAGCAGCCTGAAAGAGG + Intergenic
1150412110 17:64954016-64954038 AAAATGGAGAAGTCTAATAGCGG - Intergenic
1150664121 17:67114612-67114634 GACAAGGCAAAGCCTAATAAGGG + Intronic
1150727128 17:67660471-67660493 TACATGAAAAAGACTAATATAGG - Intronic
1150799740 17:68271294-68271316 AAAATGGAGAAGTCTAATAGCGG + Exonic
1151105822 17:71615896-71615918 CACTTGCAAAAGCCTCATAAAGG - Intergenic
1155306550 18:24484245-24484267 CACATGAAAAGGCCTAAATGAGG - Intergenic
1156873216 18:41972933-41972955 CACTTGGAAATGCATTATAGTGG + Intronic
1162221476 19:9180599-9180621 CAGATGCAAAAGCCTGAAAGGGG - Intergenic
1167071986 19:47227060-47227082 CACATGGAAAAGGCAAAATGTGG - Intronic
1167210076 19:48128596-48128618 CACATGCAAAGGCCCAGTAGTGG - Intronic
1167884761 19:52491797-52491819 CACATGGAAAAGAATAATGTTGG + Intronic
1167889197 19:52526640-52526662 CACATGGAAAAGAGTAATGTTGG + Intergenic
1167890304 19:52534973-52534995 TACATGGAAAAGAATAATATTGG + Intronic
1167891233 19:52541307-52541329 TACATGGAAAAGAATAATATTGG - Intronic
1167898406 19:52600598-52600620 CACATGGAAAAGAATAATGTTGG + Intronic
1167915428 19:52736200-52736222 CACATGGAAAAGAATAATGTTGG - Intergenic
925315102 2:2916296-2916318 CACATGTAAAAGACTAAAACTGG + Intergenic
925926292 2:8673210-8673232 CACATGGAAAGGGCTAAAAAAGG - Intergenic
929885627 2:45875141-45875163 CACCTGGAACTGCCTAAAAGGGG - Intronic
930668913 2:54127217-54127239 AAGATGGAAAACCTTAATAGGGG - Intronic
932109675 2:68986191-68986213 CAAATGAAAAAGTCTAATATCGG + Intergenic
932455612 2:71847934-71847956 GAGAAGGCAAAGCCTAATAGAGG + Intergenic
939039773 2:137174157-137174179 CATATGTAAAAGCCTAAAAATGG - Intronic
939467410 2:142576793-142576815 CACATGAAAAAGCCTCATGTAGG - Intergenic
940008397 2:149030636-149030658 CTCATGAAATAGCCTAAGAGTGG - Intergenic
940075703 2:149739529-149739551 CACATGTATAAGCCCAAGAGAGG - Intergenic
1169023687 20:2349394-2349416 CACATGGAAATGCCTTATGTGGG + Intergenic
1169340525 20:4792991-4793013 TACTTGGAAAACTCTAATAGTGG + Intronic
1170659220 20:18319777-18319799 CACATGGAGAGGCCTCATAGAGG + Intergenic
1171240650 20:23564918-23564940 CACATGGACAAGCCTGTGAGTGG + Exonic
1181987507 22:26810724-26810746 ATCATGGAAATGCCTAATGGGGG - Intergenic
1182041174 22:27239964-27239986 CACATGCAAAAGACTAGTGGTGG - Intergenic
1182210176 22:28669386-28669408 AACATGGAAATTCCTGATAGGGG + Intronic
950471383 3:13188769-13188791 CACAGGAAAAAGCCAACTAGAGG + Intergenic
952884133 3:38002433-38002455 CACTTGGAAAAGCCTTGTGGTGG - Exonic
953288808 3:41641104-41641126 CAACTGGAAAAGACTTATAGTGG - Intronic
955797563 3:62653781-62653803 CACATGGAAAAGCAGAATCTCGG - Intronic
956827749 3:73014597-73014619 CAGATTTAAAAGCCTAATAATGG - Intronic
957224809 3:77429915-77429937 AACATGGTAGAGCCTAAGAGTGG + Intronic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
957505614 3:81116576-81116598 CACAGAGAAATCCCTAATAGAGG - Intergenic
960650958 3:119949440-119949462 CAAATGTAAAAACCTAGTAGTGG + Intronic
963039692 3:141059684-141059706 CACATGTTGAAGCCTAATATAGG - Intronic
963962026 3:151320356-151320378 CACATGGAAAAGACCAACACGGG - Intronic
964306734 3:155348683-155348705 CACATGTAAAAGCATGATATTGG - Intergenic
964574286 3:158147235-158147257 CACATGGAAAAAAATAATAATGG - Intronic
966552808 3:181223978-181224000 CACATGGAAAAGCTCTTTAGTGG + Intergenic
972592761 4:40503697-40503719 AGCATGGAAGAGCCTAAGAGGGG + Intronic
973203655 4:47534460-47534482 CAGACTGAAATGCCTAATAGAGG + Intronic
974530982 4:63107650-63107672 CAGAAGGAAAAGCCTAAAATTGG - Intergenic
974858920 4:67496144-67496166 CACATGGAAAAGCCACATGGAGG + Intronic
975854441 4:78608353-78608375 CAAATGGAAAGGCCTCATGGTGG + Intronic
976212582 4:82686304-82686326 CACATTGAAAAGCGTACAAGTGG - Intronic
977093610 4:92711486-92711508 CACAAGGCAAAGCCTGAGAGTGG - Intronic
980566526 4:134550052-134550074 CACATGCAAAAGAATAATATTGG + Intergenic
983315287 4:166124554-166124576 CAGCTGGAAGAGCCTAAGAGAGG + Intergenic
983359817 4:166713500-166713522 CACAGGGAGAAGCCTGATAGTGG + Intergenic
983861004 4:172707039-172707061 CACAGGTAAAAGTGTAATAGAGG - Intronic
984705391 4:182844009-182844031 GACATGGAAAAGCTTCAGAGTGG + Intergenic
984775859 4:183481339-183481361 GCCATGGAAAATCCTATTAGTGG - Intergenic
986254654 5:6092135-6092157 CACATGGACAAGCGTGACAGGGG - Intergenic
987465596 5:18268376-18268398 TGCATGGAAAAGCCAAATAAAGG + Intergenic
987829161 5:23073908-23073930 CAAAGGGAAAAGCCTTATGGGGG - Intergenic
988334144 5:29883501-29883523 CAAATTGAAAAGCCTATAAGTGG + Intergenic
988590070 5:32540999-32541021 CACATTGAAAAGTCTAATGGTGG + Intronic
988912862 5:35862484-35862506 CAATTGGAAAACCCAAATAGAGG - Intronic
991461259 5:66861572-66861594 CACAGGGCAAAGCCTAGCAGTGG + Intronic
991712183 5:69418703-69418725 CACTTGGAATAGCCTAGGAGAGG - Intronic
996326612 5:122281960-122281982 CACATGTAAAAGAATAAAAGTGG - Intergenic
997134015 5:131305951-131305973 CACAAGGAAAAGAATAAAAGTGG - Intronic
997615228 5:135241610-135241632 CACCTGGAAGAAGCTAATAGAGG - Intronic
1000255345 5:159532970-159532992 CACATAGTGAAGCCTAAGAGGGG + Intergenic
1001854602 5:174999977-174999999 CACATGGATAAGCCACATGGAGG - Intergenic
1002480700 5:179498828-179498850 GATGTGGAAAAGCCTAACAGTGG + Intergenic
1006837250 6:37006419-37006441 GTCATCGAACAGCCTAATAGGGG + Intronic
1007835971 6:44674083-44674105 CTCCTGGAAAAGCCTCATGGAGG - Intergenic
1007949949 6:45862621-45862643 CACATGGAAAAGACTCATTGGGG + Intergenic
1008542667 6:52558787-52558809 CACATGGAAAAGCCTAATAGAGG - Intronic
1008809389 6:55475681-55475703 CACATGAGAAAGGCTAACAGTGG - Intronic
1008880041 6:56372417-56372439 CACATGGACAAGCCTGAGTGAGG - Intronic
1010028201 6:71244261-71244283 CACAATGTAAACCCTAATAGCGG - Intergenic
1010865341 6:80969624-80969646 CACATGTAAAGGCCTAATTAAGG - Intergenic
1013711098 6:112900203-112900225 CACATGTAAAAGAATAAAAGTGG - Intergenic
1019660967 7:2223845-2223867 CACCTGGAAATACCTATTAGGGG - Intronic
1022825971 7:34014232-34014254 CACATGGGAAAGGCAAGTAGAGG + Intronic
1027462596 7:78473834-78473856 CAAATGAAAAAGCCCAAAAGTGG + Intronic
1031282419 7:119820293-119820315 CACATGCAGAAGCATAATATTGG - Intergenic
1038284258 8:26192831-26192853 CACATGGGAAACCCTAACAGAGG - Intergenic
1039712192 8:40067204-40067226 CACATGGAAAGGACTACTAAGGG + Intergenic
1040821276 8:51560601-51560623 CACATGGAAAAGAATAAAACTGG + Intronic
1042884307 8:73530960-73530982 TACATGGAAAAGCACAATGGAGG + Intronic
1044953882 8:97459764-97459786 CACATTGCAAACCCTAACAGTGG - Intergenic
1046122949 8:109867731-109867753 CCCAAGGAGAAGCCTAAAAGAGG - Intergenic
1046502954 8:115101926-115101948 CACATGGAAAAGTATAATCATGG + Intergenic
1046571699 8:115974322-115974344 CAGATGAAACAGCCTCATAGAGG - Intergenic
1047148754 8:122236847-122236869 CACCTAGAAAAGCCTTATTGAGG + Intergenic
1049564044 8:143328670-143328692 CACATGCAAAGGCCTAAAACAGG + Intronic
1051418071 9:16863379-16863401 CACTAAGAAAAGCTTAATAGAGG + Intronic
1053599416 9:39595185-39595207 CAAATGCAAAAGCCTGATAGAGG + Intergenic
1053857121 9:42349370-42349392 CAAATGCAAAAGCCTGATAGAGG + Intergenic
1054568172 9:66781364-66781386 CAAATGCAAAAGCCTGATAGAGG - Intergenic
1054852988 9:69867744-69867766 CACATGGAGAAGCCACATGGAGG + Intronic
1055919537 9:81443978-81444000 CACATGCAAAAGCATAAAATTGG + Intergenic
1193444110 X:81578049-81578071 CACATGAATAAGCCTAATGGTGG + Intergenic
1196633679 X:117974492-117974514 CAGATGAAAAAGCCTCTTAGGGG - Intronic