ID: 1008544388

View in Genome Browser
Species Human (GRCh38)
Location 6:52573011-52573033
Sequence ATTCTGAGCCTATCATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008544388 Original CRISPR ATTCTGAGCCTATCATTTGT AGG (reversed) Intronic
906760278 1:48370863-48370885 ATCGTGAGCCCATCCTTTGTGGG - Intronic
906852396 1:49265599-49265621 TTTCTGAGCCTGTTATTTGTAGG + Intronic
907228513 1:52972030-52972052 CTTCTGAGGCTATCATTTGGGGG + Intronic
908236882 1:62155668-62155690 ATTCAGAGCTTTTCATTTTTAGG - Intronic
908709693 1:67001345-67001367 TTTATGAGTCAATCATTTGTAGG - Exonic
910154378 1:84197138-84197160 ATTCTGACTCTACCATTTATTGG - Intronic
910273240 1:85419939-85419961 AGTCTGGGCTTATCATTTTTTGG + Intronic
910353198 1:86323554-86323576 ATCCTGAGTCTATCATTTAATGG + Intergenic
912255907 1:108057991-108058013 AATCTGAACCTATCAACTGTAGG - Intergenic
912415448 1:109505448-109505470 ATTCTGAGAGTATCATTAATGGG + Exonic
914451250 1:147793804-147793826 ATTCAAAGCCTAACATTAGTTGG - Intergenic
918775603 1:188626028-188626050 AATATGATCCTTTCATTTGTGGG + Intergenic
918991822 1:191706595-191706617 ATTCTCAGACTTTCATTTTTAGG + Intergenic
919791444 1:201293312-201293334 CTGCGGAGCCTGTCATTTGTGGG + Intronic
921297335 1:213716979-213717001 ATTCTGAGCCTATAAATTTTGGG - Intergenic
1067072048 10:43139752-43139774 ATTCTCAGCATATTGTTTGTGGG + Intronic
1067423039 10:46174566-46174588 CTGCTGAGCCTTTCATTTGGGGG + Intergenic
1068124123 10:52816946-52816968 ATTTTGACTCTATCATTTTTTGG + Intergenic
1068347318 10:55798733-55798755 CTGCTGAGGCTTTCATTTGTGGG - Intergenic
1079705179 11:23606979-23607001 ATTCTGATCCTATTAAATGTGGG + Intergenic
1081545019 11:44065784-44065806 TTTCTGCCCCTTTCATTTGTAGG - Intergenic
1083067337 11:59938775-59938797 ATTCTGACCATATCAATTCTTGG + Intergenic
1083269869 11:61566620-61566642 ATTCTGAGCCCCTCCTTTCTTGG - Intronic
1087297414 11:96392877-96392899 ATTCTGATCAATTCATTTGTAGG + Exonic
1089824252 11:121259367-121259389 ATTCTGTGCTTATCATTTTAAGG + Intergenic
1090018926 11:123109921-123109943 TTTCTCACCCTATCATTTGCCGG - Intronic
1090534051 11:127620989-127621011 ATTGAGAGCTTATCATGTGTTGG - Intergenic
1092276182 12:7062510-7062532 ATGCTGAGCCTACCATGTATGGG + Exonic
1094300912 12:28964479-28964501 TTTCTCTGCCTACCATTTGTAGG + Intergenic
1095299195 12:40562432-40562454 ATTTTGGGCCTATTAGTTGTTGG + Intronic
1097964630 12:65565487-65565509 ATTCTGCCTCTATCATTTATAGG - Intergenic
1101249043 12:102914298-102914320 ATTTAGAGCCTATAATTTCTGGG + Intronic
1101533211 12:105593887-105593909 ATCCTGAGGCTGTCATATGTAGG - Intergenic
1103875666 12:124125212-124125234 ATCCTGAGGATATCATTTTTGGG + Intronic
1106819474 13:33447805-33447827 ATTCTGAGGATAAAATTTGTTGG - Intergenic
1107557499 13:41529998-41530020 ATTCTGATCCATTGATTTGTAGG - Intergenic
1108537929 13:51405477-51405499 ATACTTAGCCTATCAATTCTTGG + Intronic
1108699729 13:52933533-52933555 ATCCTGAGCCTAGCATCTGCAGG + Intergenic
1110265840 13:73536579-73536601 ATTCTCTGCCTGGCATTTGTTGG - Intergenic
1110564153 13:76941070-76941092 CTTCTGAGGCTTTCATTTGAAGG + Intergenic
1110617854 13:77561148-77561170 ATGGTGAGCCTCTCCTTTGTTGG - Intronic
1111233829 13:85381701-85381723 ATTTAGAAGCTATCATTTGTAGG - Intergenic
1111874503 13:93876531-93876553 ATTCTGAAACTCTCATTTTTAGG - Intronic
1112626552 13:101111185-101111207 ATGCTGAGCGGATCATTTGAGGG - Exonic
1112960427 13:105119016-105119038 ATTGTTATCCAATCATTTGTTGG + Intergenic
1118142571 14:63100622-63100644 GTTCTGAGACTATCGTTTGGAGG - Intronic
1120609268 14:86620555-86620577 ATTTTGAGTTTATCATGTGTCGG - Intergenic
1122945569 14:105007085-105007107 GCTCAGAGCCTATCATTTTTAGG + Intronic
1125394740 15:39234461-39234483 ATTCTTAGCATATCAGTTGTGGG - Intergenic
1128200479 15:65801772-65801794 ATTATTAGCCTATCATTCCTAGG + Intronic
1128632388 15:69280028-69280050 ATTCTGAGCTAATCAGTTCTTGG + Intergenic
1130120604 15:81044300-81044322 ATTCTGACACTATCATTTGTTGG + Intronic
1130346258 15:83048499-83048521 ATTGTTAGCCTATCATTAGATGG + Intronic
1137464467 16:48695765-48695787 ATTTTGAGCTTATTTTTTGTTGG - Intergenic
1137805548 16:51301760-51301782 ATTGTGATCCTCACATTTGTGGG + Intergenic
1137977997 16:53047197-53047219 ATACTGACCCTGTCATATGTTGG + Intergenic
1138575856 16:57906918-57906940 ATGCAGGGCCTAGCATTTGTAGG + Intronic
1138907635 16:61356868-61356890 ATTCTGTGCCTATTTTTTATGGG - Intergenic
1146118040 17:30160424-30160446 ATTCTGAGCTTTTCTTTTTTAGG + Intronic
1146960392 17:36970352-36970374 ATTCTTTGCCTTTCTTTTGTGGG + Intronic
1147215209 17:38895100-38895122 ATTATGTGCCTACCATGTGTTGG - Intronic
1148324675 17:46776384-46776406 ATTATGGGCCTATCATGTGCTGG + Intronic
1148929706 17:51118679-51118701 ATTGTGATCCTATCATTATTTGG + Intronic
1149276337 17:55042216-55042238 AATCAGAGACTATGATTTGTGGG + Intronic
1149661059 17:58334065-58334087 ATTCTGTGACTCTCTTTTGTGGG - Intergenic
1153202783 18:2662977-2662999 ATTCTGAGCCCATCAAGTGTAGG - Intronic
1154046252 18:10907826-10907848 AATCTGTGCCTATCAAATGTTGG - Intronic
1154273781 18:12942243-12942265 AGTCTGAGTCTCTCATATGTAGG + Intergenic
1155415084 18:25589499-25589521 ATTCTCCCCCTATCATTTCTAGG + Intergenic
1155559255 18:27058028-27058050 ATTCTGAGGCAGTCATTTCTTGG + Intronic
1155743501 18:29320264-29320286 ATCCTGATCCTATCATTTTTTGG - Intergenic
1156088328 18:33436297-33436319 ACTCTGCTCCTATCATTTATGGG - Intronic
1157041263 18:44042180-44042202 ATTCTGTGCCTCTCTCTTGTCGG - Intergenic
1157235419 18:45960719-45960741 ATTCTGGGCATTTCATTTCTGGG + Intronic
1158028469 18:52932714-52932736 ATTCTGAGTCTATCATCTTCAGG - Intronic
1158281843 18:55836829-55836851 AATCTGAGATTATCATTTGATGG + Intergenic
1159434158 18:68394456-68394478 CTTCTCAGCCTAGTATTTGTAGG - Intergenic
1159817399 18:73092839-73092861 TTTTGGAGTCTATCATTTGTTGG - Intergenic
1165260762 19:34615393-34615415 ATTCTCAGCTGATCATGTGTAGG + Intronic
925511200 2:4627161-4627183 ATTCAGAGCCTTTCCTTTGGGGG + Intergenic
929961122 2:46497076-46497098 AGTCAGTGCCTAACATTTGTGGG - Intronic
931682436 2:64762616-64762638 CTTTTGAACCTATGATTTGTAGG - Intergenic
933077694 2:77950362-77950384 GTTCTCAGCATATCATTTATAGG + Intergenic
933323294 2:80804543-80804565 ATTCTGAGCTTATTATTTCATGG - Intergenic
938676352 2:133639156-133639178 ATTCAGAGAATATCAATTGTTGG + Intergenic
939547084 2:143567350-143567372 AATCAGAGCCTATCCTTTGCTGG - Intronic
946986103 2:225275286-225275308 ACAGTGTGCCTATCATTTGTTGG + Intergenic
1171044468 20:21797415-21797437 ATTCTCTGCCTTTCATTTGGAGG + Intergenic
1171222871 20:23416918-23416940 ATTATGAATCTATAATTTGTTGG - Intronic
1173012982 20:39199407-39199429 TCTCTGAGCCTATCTTGTGTTGG + Intergenic
1177626372 21:23665692-23665714 ATTCTGAGCCTGTCATATATGGG - Intergenic
1177704345 21:24681838-24681860 ATTCTTAGCATATCAATTTTAGG - Intergenic
1179137050 21:38688707-38688729 ATTCTGAGCATATAATTGATTGG - Intergenic
1179307550 21:40168836-40168858 ATTCTGGTTCTATCACTTGTTGG + Intronic
1179614906 21:42576473-42576495 ATTGTGAGCTCATCTTTTGTAGG - Intronic
952062813 3:29530952-29530974 ATTCTGATCCCACCATTTTTGGG - Intronic
956240910 3:67129736-67129758 ATTATGACCCTGACATTTGTGGG - Intergenic
957928451 3:86845696-86845718 ATTCTGAGTCTTTAATTTGATGG + Intergenic
960755764 3:121010325-121010347 ATCCAGAGCCTATCAATTGAAGG - Intronic
961669706 3:128519999-128520021 ATTCTGAGACTGTCATTTACTGG + Intergenic
964444860 3:156748171-156748193 ATTCTGAGTCAATAATTTGAAGG - Intergenic
965268033 3:166572747-166572769 ATTCTGAGCCAAGCATCTGGAGG + Intergenic
966213968 3:177481966-177481988 ATTCAAAGCCTATCAAATGTAGG + Intergenic
966835383 3:184045669-184045691 ATTCTGAGCCTGGCATTTTCTGG + Intergenic
972015549 4:34239659-34239681 ATTCTCAGGTTATAATTTGTGGG - Intergenic
972050155 4:34721711-34721733 CTTCTGAGGCCTTCATTTGTGGG - Intergenic
972130634 4:35829317-35829339 ACTCTGAGTTTATCTTTTGTAGG - Intergenic
973102383 4:46289309-46289331 TTTCTTAGTCTACCATTTGTGGG - Intronic
973560164 4:52127574-52127596 GTTCTCAGCATATCATTTCTGGG - Intergenic
975858616 4:78651808-78651830 ATTCTAAGCCTGCCATTTGCTGG - Intergenic
977268813 4:94889340-94889362 TTTCTGAGCCAAACATTTCTAGG + Intronic
977348822 4:95853492-95853514 ATTCTGAGGCTTTCATTTTGGGG + Intergenic
977710257 4:100116320-100116342 ATTCTGAGCCAATTCGTTGTAGG - Intergenic
977808984 4:101336900-101336922 ATTCTGGGAGTCTCATTTGTAGG + Intronic
980826923 4:138084757-138084779 ATATTAAGCCTATCATTGGTTGG - Intergenic
983019841 4:162662015-162662037 AGTCTCAGCATGTCATTTGTAGG + Intergenic
983585848 4:169353661-169353683 ATACTGAGACTAGGATTTGTAGG - Intergenic
986580715 5:9263070-9263092 ATTCTGAACCGATTTTTTGTTGG - Intronic
986803864 5:11289698-11289720 ATTCTGAGCCTCTCTTTTAGAGG - Intronic
987469949 5:18315645-18315667 ATTCTGTTCCTGTCAATTGTTGG + Intergenic
991269649 5:64764742-64764764 TATCTGATCCTATCATTGGTGGG - Intronic
992098725 5:73385288-73385310 TTTCTAAGCCAATCATTTGCAGG - Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
1001106748 5:168860916-168860938 ATGCTGTGCCTCTCATTTCTAGG + Intronic
1008394020 6:50985954-50985976 ATTCTGACTCTATCATTTACTGG - Intergenic
1008413001 6:51205085-51205107 ATTCTGTCCCTTTCATTTGCTGG - Intergenic
1008544388 6:52573011-52573033 ATTCTGAGCCTATCATTTGTAGG - Intronic
1008665740 6:53714372-53714394 ATTCTGTGCCTAGCCTTTTTCGG + Intergenic
1008839422 6:55882580-55882602 ATTCTGATTCTATCATATATGGG - Intergenic
1015410163 6:132885529-132885551 ATTGTGAGCCTCTAATTTTTAGG - Intergenic
1020475580 7:8590157-8590179 ATTCTGACACTAACATTTGGGGG + Intronic
1024743052 7:52375952-52375974 ATTCTGAGCCCATCAAATGAAGG + Intergenic
1026711658 7:72746398-72746420 ACTCTGTGACTAGCATTTGTTGG - Intronic
1027336536 7:77156814-77156836 ATTCTGAGCCTGTCATATAGTGG + Intronic
1028329875 7:89576921-89576943 ATTCTGTGCCTTTTATTTGGAGG - Intergenic
1028776990 7:94688425-94688447 ATTCTGGGCCTATGATAGGTGGG + Intergenic
1029779255 7:102714295-102714317 ATTCTGAGCCTGTCATATAGTGG - Intergenic
1032007045 7:128310931-128310953 TTTCTAATCCTTTCATTTGTAGG - Exonic
1032333543 7:131003023-131003045 AGTATGAGCTTATCTTTTGTAGG - Intergenic
1033006177 7:137566708-137566730 ATTCTTCTCCTATCATTTGTAGG - Intronic
1036985249 8:13521677-13521699 ATTCTCAGCCCACCATTTGGGGG + Intergenic
1038603043 8:28967845-28967867 AATCAGACCCTAACATTTGTAGG + Intronic
1039077289 8:33703242-33703264 ATTATGAGCCTATTATGTGTTGG + Intergenic
1040351200 8:46570763-46570785 ATTCTTAGTATATCATTAGTGGG + Intergenic
1041043793 8:53872644-53872666 ATTCTGCTCCTAGCATTTGATGG - Intronic
1042978504 8:74499175-74499197 ATTGTGAGCTTAACATGTGTGGG + Intergenic
1043188719 8:77189725-77189747 ATTATGAGCTTATCATTCATGGG + Intergenic
1047139179 8:122117359-122117381 ATTCTGGGCTTATTTTTTGTTGG - Intergenic
1047346269 8:124031740-124031762 CTTCTGAGGCTTTCATTTGGGGG + Intronic
1050785875 9:9400997-9401019 ATTGTGATCATATGATTTGTTGG + Intronic
1055472997 9:76632472-76632494 AGACGGAGCCTATCATTTCTAGG + Intronic
1055897628 9:81197533-81197555 ATTCTGGCTCTATCATTTGTTGG - Intergenic
1185889329 X:3810392-3810414 ATTCTGAGCATATCCTTTTAAGG - Intergenic
1187611319 X:20946874-20946896 ATTTCAAGCCTCTCATTTGTAGG - Intergenic
1195789076 X:108561364-108561386 AGTCTCAACCTATCAGTTGTGGG + Intronic
1201594621 Y:15653936-15653958 ATTGTGAGCCTTTCAGATGTTGG + Intergenic