ID: 1008545174

View in Genome Browser
Species Human (GRCh38)
Location 6:52577268-52577290
Sequence GCCGGGCGCGGCGCTGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008545174_1008545180 -10 Left 1008545174 6:52577268-52577290 CCCGCGCCAGCGCCGCGCCCGGC No data
Right 1008545180 6:52577281-52577303 CGCGCCCGGCCGCATTCTCGGGG No data
1008545174_1008545185 12 Left 1008545174 6:52577268-52577290 CCCGCGCCAGCGCCGCGCCCGGC No data
Right 1008545185 6:52577303-52577325 GCCCGAGGCTCAGCCGCTCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
1008545174_1008545183 -3 Left 1008545174 6:52577268-52577290 CCCGCGCCAGCGCCGCGCCCGGC No data
Right 1008545183 6:52577288-52577310 GGCCGCATTCTCGGGGCCCGAGG 0: 1
1: 0
2: 1
3: 6
4: 92
1008545174_1008545188 15 Left 1008545174 6:52577268-52577290 CCCGCGCCAGCGCCGCGCCCGGC No data
Right 1008545188 6:52577306-52577328 CGAGGCTCAGCCGCTCGCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1008545174_1008545190 25 Left 1008545174 6:52577268-52577290 CCCGCGCCAGCGCCGCGCCCGGC No data
Right 1008545190 6:52577316-52577338 CCGCTCGCGGTGGAGAAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008545174 Original CRISPR GCCGGGCGCGGCGCTGGCGC GGG (reversed) Intergenic