ID: 1008547010

View in Genome Browser
Species Human (GRCh38)
Location 6:52592002-52592024
Sequence GAGCCAAGCATGGTTACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008547003_1008547010 3 Left 1008547003 6:52591976-52591998 CCCAGGAGACATTCCCTAATCAG No data
Right 1008547010 6:52592002-52592024 GAGCCAAGCATGGTTACCCCAGG No data
1008547000_1008547010 16 Left 1008547000 6:52591963-52591985 CCTGTTGCCCATTCCCAGGAGAC No data
Right 1008547010 6:52592002-52592024 GAGCCAAGCATGGTTACCCCAGG No data
1008547002_1008547010 8 Left 1008547002 6:52591971-52591993 CCATTCCCAGGAGACATTCCCTA No data
Right 1008547010 6:52592002-52592024 GAGCCAAGCATGGTTACCCCAGG No data
1008547007_1008547010 -10 Left 1008547007 6:52591989-52592011 CCCTAATCAGGGTGAGCCAAGCA No data
Right 1008547010 6:52592002-52592024 GAGCCAAGCATGGTTACCCCAGG No data
1008547004_1008547010 2 Left 1008547004 6:52591977-52591999 CCAGGAGACATTCCCTAATCAGG No data
Right 1008547010 6:52592002-52592024 GAGCCAAGCATGGTTACCCCAGG No data
1008547001_1008547010 9 Left 1008547001 6:52591970-52591992 CCCATTCCCAGGAGACATTCCCT No data
Right 1008547010 6:52592002-52592024 GAGCCAAGCATGGTTACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008547010 Original CRISPR GAGCCAAGCATGGTTACCCC AGG Intergenic
No off target data available for this crispr