ID: 1008549626

View in Genome Browser
Species Human (GRCh38)
Location 6:52615239-52615261
Sequence CTGTGAAAAAATATGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008549624_1008549626 -6 Left 1008549624 6:52615222-52615244 CCTTCTATGTGGTGGTGCTGTGA No data
Right 1008549626 6:52615239-52615261 CTGTGAAAAAATATGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008549626 Original CRISPR CTGTGAAAAAATATGGTGCA TGG Intergenic
No off target data available for this crispr