ID: 1008549939

View in Genome Browser
Species Human (GRCh38)
Location 6:52619179-52619201
Sequence TCATTCACATATATAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008549939_1008549943 18 Left 1008549939 6:52619179-52619201 CCTCTCTCTATATATGTGAATGA No data
Right 1008549943 6:52619220-52619242 TGGAAGAAAGGATTATCAGTAGG No data
1008549939_1008549940 -2 Left 1008549939 6:52619179-52619201 CCTCTCTCTATATATGTGAATGA No data
Right 1008549940 6:52619200-52619222 GAAATATCACAATCCAATGATGG No data
1008549939_1008549941 6 Left 1008549939 6:52619179-52619201 CCTCTCTCTATATATGTGAATGA No data
Right 1008549941 6:52619208-52619230 ACAATCCAATGATGGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008549939 Original CRISPR TCATTCACATATATAGAGAG AGG (reversed) Intergenic
No off target data available for this crispr