ID: 1008555918

View in Genome Browser
Species Human (GRCh38)
Location 6:52672736-52672758
Sequence CAATGAGAATGGAGAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 997
Summary {0: 1, 1: 2, 2: 12, 3: 104, 4: 878}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008555918 Original CRISPR CAATGAGAATGGAGAGAAGG TGG (reversed) Intronic
900685331 1:3944553-3944575 CAAGGAGGATGGCGAGGAGGAGG - Intergenic
900993341 1:6107835-6107857 GAAGGATAATGGAGAGATGGAGG + Intronic
901362607 1:8715571-8715593 CAATGAGAAGGAAGAGGAAGAGG + Intronic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
901811072 1:11766980-11767002 CAAGCAGAAAGGAGAGGAGGGGG + Exonic
901847075 1:11990156-11990178 AAAGCAGAATGGAAAGAAGGTGG - Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902589043 1:17460429-17460451 CAATTGGGATGCAGAGAAGGAGG - Intergenic
902670036 1:17966845-17966867 CAAGGACAAAGGAGTGAAGGTGG - Intergenic
903331681 1:22599970-22599992 CAAGAAGGAAGGAGAGAAGGAGG + Intronic
904233369 1:29096328-29096350 CAAGGAGACAGAAGAGAAGGAGG + Intronic
904275808 1:29383497-29383519 CAGTGAGACTGAAGAGATGGGGG - Intergenic
904390766 1:30184346-30184368 AAATGAGGAAGGAGAGAAAGGGG - Intergenic
904581788 1:31549055-31549077 CACTGAGAATGGCCAGTAGGTGG - Intergenic
904853474 1:33477351-33477373 AATTGAGAATGGAGAGATGGTGG - Intronic
905135392 1:35795336-35795358 TAATGAGAAAGCAGAGCAGGAGG - Intergenic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905977233 1:42185188-42185210 CAATAAGAATTCAGAGAAAGGGG - Intronic
906026643 1:42679844-42679866 CAATGTGTATGGAGAGTGGGTGG - Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907795970 1:57717426-57717448 CATTGAGGATGTAGAGAAAGGGG + Intronic
908318841 1:62961632-62961654 AAATCAGAATGGGGAGGAGGGGG - Intergenic
908757117 1:67479311-67479333 CAGTGAGAGTGGAGTGAGGGAGG + Intergenic
908771903 1:67605127-67605149 CAATGAGCCAGGAGAGAAGGAGG - Intergenic
908871957 1:68623593-68623615 CCAACAGAATGGAGAGAAGGTGG - Intergenic
909008023 1:70300185-70300207 AAATGAGAATGAAGAGAAGTTGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909472895 1:76049342-76049364 GAATGAGAAGGAAGAAAAGGTGG - Intergenic
909487093 1:76186432-76186454 CTATGAGAATGGAATGAAGGAGG - Intronic
909855176 1:80520934-80520956 CAAAGAGAAAGGAAAAAAGGAGG + Intergenic
910064992 1:83141900-83141922 GAATGAGAACTGAGTGAAGGGGG - Intergenic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
911058193 1:93725116-93725138 CATAGACAATGAAGAGAAGGAGG - Intronic
911090619 1:94014298-94014320 CAATGAAAAAGGAAGGAAGGAGG + Intronic
911251905 1:95585895-95585917 AAATGAAGATGGAGAGGAGGGGG - Intergenic
911406126 1:97442052-97442074 CAAAGAGACTGGAAAAAAGGAGG - Intronic
911656897 1:100454322-100454344 CCCTGAGGATGGAGACAAGGAGG + Intronic
911876720 1:103174717-103174739 CAATGAGAATGATGGGGAGGAGG + Intergenic
912022603 1:105123754-105123776 CAATGAAAATATAGAGAAGATGG + Intergenic
912054770 1:105581114-105581136 GAATGAGAAGGGAGGGAGGGGGG - Intergenic
912164963 1:107032137-107032159 GAATGAGTATAGAGAGAAGAAGG - Intergenic
912527234 1:110292418-110292440 CGATGTGAATGGGGAGAAGCTGG - Intergenic
912634137 1:111275749-111275771 CAAAGATAATGGAGAGACAGGGG - Intergenic
912646805 1:111400747-111400769 AAATGAGAATGGAAAGAGGTAGG + Intergenic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
913175295 1:116267705-116267727 CCATGAAAATCGAGATAAGGTGG + Intergenic
913176073 1:116274253-116274275 GAATGAGAATGAGGAGGAGGAGG + Intergenic
913466198 1:119145440-119145462 TGATGAGAGTTGAGAGAAGGTGG + Intergenic
913679620 1:121176803-121176825 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914031454 1:143964450-143964472 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914157993 1:145103514-145103536 CAATGGGAGTTGAGAGGAGGAGG + Intronic
914383590 1:147144877-147144899 GAAGGAGAATGGAGAGATGATGG - Intergenic
914446628 1:147756440-147756462 AAATGAGAGTGGAGAGGTGGAGG - Exonic
914833477 1:151188399-151188421 TAATGAGAATGGCTTGAAGGGGG - Intronic
915739480 1:158107689-158107711 AAGTAAGAATGGAGAGAAGGTGG - Intergenic
915758885 1:158291060-158291082 CAAGGAAAATGGAGAGAAAATGG - Intronic
915791703 1:158679164-158679186 GAATGAAAATGGAGAGAAACAGG - Intronic
916127318 1:161582735-161582757 CAATAAGAATGGAAAAAATGGGG - Intronic
916137237 1:161664539-161664561 CAATAAGAATGGAAAAAATGGGG - Intronic
916295371 1:163213435-163213457 CAGAAAGAATGGAGAGGAGGGGG - Intronic
916368407 1:164061053-164061075 CATTGAGAGTGGACAGAGGGAGG + Intergenic
916612652 1:166408524-166408546 CAGTGAGAATGGAAACAAGTTGG - Intergenic
916987393 1:170206558-170206580 GAATGAGAATTCAGCGAAGGGGG - Intergenic
916987667 1:170208540-170208562 GAATGAGAATCAAGTGAAGGGGG - Intergenic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
918515449 1:185358348-185358370 CATTGAGAGTGGACAGAGGGAGG + Intergenic
919061495 1:192639479-192639501 CAACAAAAATGAAGAGAAGGAGG + Intronic
919201670 1:194362822-194362844 CAATAAGAATGGAGAGGATGGGG + Intergenic
919521196 1:198590487-198590509 CAGGGAGAATGGAGAGAAAGTGG - Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920351561 1:205341336-205341358 CAATAAGATTGGAAAGTAGGAGG - Intronic
920466926 1:206195347-206195369 CAATGGGAGTTGAGAGGAGGAGG - Intronic
920503646 1:206501279-206501301 GAGTGAGAAAGGAGAGAGGGAGG + Intergenic
920646478 1:207807643-207807665 CAAAGAGGAAGGAGAGAAAGTGG - Intergenic
920838209 1:209531634-209531656 AAATGAGAAAGGAGAGAGAGTGG + Intergenic
921363050 1:214347892-214347914 CAATGAAAATGGAGATAAATCGG - Intergenic
921466236 1:215491739-215491761 CAATCATAATGGAAGGAAGGAGG - Intergenic
921761407 1:218919398-218919420 CCAGGAGAAAGGAGAGAAGTGGG - Intergenic
922026679 1:221756270-221756292 TAATGAGGATAGAGAGAAGAGGG - Intergenic
922088179 1:222370609-222370631 CCATGGGAAAGGAGAGAAGGAGG + Intergenic
923221094 1:231893820-231893842 TGAAGAGAAAGGAGAGAAGGAGG + Intronic
923241985 1:232095069-232095091 CCAGGAGGATGGAGAGAAGGAGG - Intergenic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923352611 1:233124082-233124104 GAATGAGAATGAGGAGAAGAAGG - Intronic
923570819 1:235112710-235112732 CACTGATAATTGAGTGAAGGAGG + Intronic
923893059 1:238237038-238237060 CATTGAGAAGGCTGAGAAGGAGG + Intergenic
923978160 1:239288424-239288446 CAAAGAGAAAGGAGAGTTGGTGG - Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924024227 1:239816185-239816207 CATCCAGAATGCAGAGAAGGCGG + Intronic
924288221 1:242510038-242510060 CAATGAGAACGAAGAAAAGATGG - Intronic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
1062922922 10:1293280-1293302 GAAAGAGCAGGGAGAGAAGGGGG + Intronic
1062975029 10:1676845-1676867 TGAAGAGGATGGAGAGAAGGTGG + Intronic
1063057048 10:2517037-2517059 CAGGGACAATGGAAAGAAGGAGG - Intergenic
1063713112 10:8499992-8500014 GAAAGAGAAAGGAGGGAAGGAGG - Intergenic
1063862606 10:10327918-10327940 CTTTGAGAAAGGATAGAAGGAGG + Intergenic
1063897985 10:10702216-10702238 CACTAAAAATGGGGAGAAGGGGG + Intergenic
1064135171 10:12744459-12744481 CAATGAGAATGTAGAGAAAGTGG - Intronic
1064304427 10:14152582-14152604 CATTAAGAATAGAGAGAAGCCGG + Intronic
1064719699 10:18216658-18216680 CATTGAGACTGGAGAGAGGAAGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065532152 10:26682249-26682271 AAGTGAGAATGCAGATAAGGGGG + Intergenic
1065975936 10:30842437-30842459 CATTGAGAATGGTGGGAAGAGGG - Intronic
1066028740 10:31394871-31394893 CAATGAGGATGAAGAGAGGTGGG + Intronic
1066162199 10:32746158-32746180 CATTGAGAGTGGACAGAGGGAGG + Intronic
1066203060 10:33160349-33160371 CAGTGAGAATGTAGGGAATGTGG - Intergenic
1066714828 10:38275571-38275593 AACTGAAAATAGAGAGAAGGGGG - Intergenic
1066783249 10:38975131-38975153 AACTGAAAATAGAGAGAAGGGGG + Intergenic
1067177766 10:43962233-43962255 AAAGGAGAATGGGGAGGAGGAGG + Intergenic
1067312400 10:45126503-45126525 CAAAGAGAATGGGGGCAAGGGGG + Intergenic
1067404654 10:46010645-46010667 TGATGAGAATTGTGAGAAGGAGG - Exonic
1067829339 10:49601203-49601225 CAAAGAGAATGTAAAGCAGGAGG + Intergenic
1068880190 10:62040124-62040146 GAGTGAGAATGGAGAGAGAGAGG - Intronic
1068897214 10:62219188-62219210 GAATGAGAATGGTGAGTAGCAGG + Intronic
1068973302 10:62981717-62981739 AAATGACAAAGGTGAGAAGGTGG - Intergenic
1069129955 10:64687220-64687242 GAATGAGAAACGAGTGAAGGGGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1070282425 10:75059391-75059413 AAAGGAGACTGGAGAGAAGGAGG + Intergenic
1070622209 10:78021739-78021761 CAATAAGAACGGAGAGACTGAGG + Intronic
1070875537 10:79803450-79803472 CAATGAAAGTGGAGTGAAGTTGG + Intergenic
1071483376 10:86081014-86081036 CACTGACAAGGGAGAGGAGGAGG + Intronic
1071517885 10:86311048-86311070 CAAGGAGAAAGGAGAGAGGGAGG + Intronic
1071839556 10:89455056-89455078 GAATGAGAAAGGGAAGAAGGAGG + Intronic
1072026673 10:91467035-91467057 CATTGAGATTGGACAGATGGAGG + Intronic
1072111785 10:92328604-92328626 AAATGAGAATGGAAAGAATGGGG - Intronic
1072576271 10:96703342-96703364 CAATGGGAATGGAGAGGGAGGGG + Intronic
1073117150 10:101097620-101097642 ACATGAGACTGGAGAGAAGCTGG - Intronic
1073688784 10:105784868-105784890 CAAGGAGAATAGAGTGTAGGAGG + Intergenic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074058071 10:109940675-109940697 AATTGAGAATTGAGAGGAGGAGG + Intergenic
1074269919 10:111944238-111944260 CACTGAGAAGGGAGAAAAGCAGG + Intergenic
1075190789 10:120306506-120306528 AAAAGAGATTGGAGAGAGGGAGG + Intergenic
1077147056 11:1051038-1051060 CACTGAGAAGGGAGAGAAGCTGG - Intergenic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1077867924 11:6238596-6238618 CTATGAGAATGGTGTGATGGGGG + Intronic
1078002423 11:7508173-7508195 CAATGAGTAGGCTGAGAAGGAGG + Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078403410 11:11047175-11047197 TTATGAGAATGGAGAAGAGGGGG + Intergenic
1078676237 11:13417199-13417221 CAATGAGAAAGGAGAGTATGAGG - Exonic
1078759480 11:14240739-14240761 CAATGTGGGTGGAGTGAAGGTGG - Intronic
1079050617 11:17154750-17154772 CAAGGAGAATTGAAGGAAGGGGG + Intronic
1079166289 11:18046333-18046355 CAATGAGAAGGGAGGGCCGGCGG + Intergenic
1079166806 11:18051785-18051807 AAATGAGAATGGGTAGGAGGAGG - Intergenic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1079490507 11:20983929-20983951 TAATGTGAATGGAGACAAAGAGG - Intronic
1079747431 11:24150810-24150832 CATTGAGAGTGGACAGAAAGAGG - Intergenic
1080290550 11:30666064-30666086 GAAGGAGAAGGGGGAGAAGGAGG + Intergenic
1081292871 11:41348652-41348674 CATTGAGAATGGATGGAGGGAGG + Intronic
1081335122 11:41856085-41856107 AAAAAAGAATGGAGACAAGGTGG + Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081542716 11:44047957-44047979 CATTGACAATGGAGCAAAGGAGG - Intergenic
1081665982 11:44917435-44917457 GAATAAGATTGGAGGGAAGGTGG - Intronic
1081889846 11:46531737-46531759 GAATGAGGATAGAGTGAAGGAGG - Intronic
1081896644 11:46592914-46592936 CAAAGAGGCTGGGGAGAAGGAGG + Intronic
1083788410 11:64968106-64968128 CATTGAGAATGAAGAGAGAGAGG + Intronic
1083855907 11:65393009-65393031 CAGTGAGAGAGGAGATAAGGTGG + Intronic
1084457432 11:69276182-69276204 CCATGAGACTGAAGAGTAGGGGG + Intergenic
1085630544 11:78112297-78112319 GAATAGGAATGGTGAGAAGGGGG + Intronic
1086347293 11:85909994-85910016 AAATAAGAATGGGGAGAAGCAGG - Intronic
1086990873 11:93303166-93303188 CATGGAGAATGGAGAAAAGCAGG + Intergenic
1087104691 11:94398002-94398024 CAATGTGAAGGGTGAGAAGTTGG - Intronic
1087734047 11:101811537-101811559 GAATGAGAACTGAGTGAAGGAGG - Intronic
1087870116 11:103283348-103283370 CTATGAGAATGGTGACATGGGGG + Intronic
1088114409 11:106299034-106299056 CAACGAGTATGTGGAGAAGGAGG + Intergenic
1088206951 11:107403515-107403537 CAAGGAGAATGGGCAGGAGGGGG - Intronic
1088377115 11:109153200-109153222 AGCTGAGAATGGAGAAAAGGTGG + Intergenic
1088828581 11:113516145-113516167 AAATGAGAAGAGAGAGCAGGAGG - Intergenic
1088936313 11:114404015-114404037 GAATGAAAATGGAGAGCAGTAGG + Intronic
1089396745 11:118141096-118141118 GAATGGGAATGGGGGGAAGGAGG + Intronic
1090678233 11:129025664-129025686 AAAAGAGAAAGAAGAGAAGGAGG + Intronic
1091569180 12:1669626-1669648 GAATGGGAATGGGGAGAAGTAGG + Intergenic
1092679180 12:10958398-10958420 CTATGTGAACAGAGAGAAGGAGG + Intronic
1093060900 12:14602319-14602341 TAATGAGGATGTAGAGAAAGAGG - Intergenic
1093128661 12:15362058-15362080 ATATGAGAATGGAGAGAAGGAGG - Intronic
1093457068 12:19374972-19374994 TAATAATAATGAAGAGAAGGAGG + Intronic
1093743714 12:22716027-22716049 CAGAGAGAAAGGATAGAAGGAGG + Intergenic
1093925658 12:24905969-24905991 CAGCAAGAATGGAGATAAGGTGG + Intronic
1094088490 12:26621158-26621180 CTATGAGAATGGAGAAATAGGGG - Exonic
1094310489 12:29075271-29075293 CTTTGAGAATGGTGAGAGGGGGG + Intergenic
1094646289 12:32327874-32327896 CAAGGAGAGTGGTGAGAAGATGG + Exonic
1094708361 12:32936713-32936735 AAATGAGACTGGAGAAAAGCGGG + Intergenic
1095754594 12:45750225-45750247 CAAGGAGAAGGGAGAGAAATGGG + Intronic
1095941717 12:47731728-47731750 AAATGACAATAGTGAGAAGGTGG + Intergenic
1096501947 12:52069660-52069682 CATAGAGACTGGAGGGAAGGAGG - Intronic
1097328287 12:58304126-58304148 CAATATAAATGCAGAGAAGGTGG + Intergenic
1097478283 12:60086676-60086698 GAAAGAGAAAGGAGAGAAGAAGG + Intergenic
1097720904 12:63020154-63020176 CAAAGAGAATACAGAGAGGGAGG - Intergenic
1098083172 12:66811648-66811670 CAAGGAGAAAGAAGGGAAGGAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098441313 12:70522197-70522219 CATTTAGAATGGAGATAAGAGGG + Intronic
1098788661 12:74791795-74791817 CAATGAGAATGGGGACATGAAGG + Intergenic
1098901698 12:76117970-76117992 CAATGAGAAGGGAGAACAGGTGG - Intergenic
1099054588 12:77823322-77823344 CAAAGAGATAGGAGAGAATGAGG + Intergenic
1099096793 12:78384098-78384120 CAGTAAGAATGGATAGAAAGTGG - Intergenic
1099490159 12:83278962-83278984 CAAAGAGAAAGGAGAGATGAGGG + Intergenic
1099614286 12:84914477-84914499 CAATGCCAATGAAGAGAAGTAGG + Intergenic
1099697999 12:86045084-86045106 CATTGAGGGTGGACAGAAGGAGG - Intronic
1100021506 12:90074835-90074857 GAAGGAGAAGGAAGAGAAGGAGG - Intergenic
1100073161 12:90746469-90746491 GAATGAGAATGATGAGATGGTGG + Intergenic
1100399653 12:94217704-94217726 CAATGAAAAGGGAAAGAACGAGG - Intronic
1100555462 12:95688755-95688777 TAAGGAGAAGGTAGAGAAGGAGG + Intronic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1101061698 12:100979123-100979145 GAAGGAGAATGAAGAGAGGGTGG + Intronic
1101232892 12:102759494-102759516 CAATGAGAATAGAAAGAAAGTGG + Intergenic
1101745656 12:107539460-107539482 ACATGAGAATGGAGAGAAAAAGG + Intronic
1101763346 12:107677163-107677185 AAATGAGAATGAAGAGAAAGGGG + Intergenic
1102079463 12:110086273-110086295 CAATGAGAGGGCACAGAAGGTGG + Intergenic
1102406848 12:112680865-112680887 AAAGGAGAAAGAAGAGAAGGAGG - Intronic
1102565408 12:113794378-113794400 CACTGTGCATGGAGAGGAGGAGG - Intergenic
1103081199 12:118025259-118025281 CAATGACAAAGAAGAGTAGGAGG - Intronic
1103463438 12:121123160-121123182 CAATGAGAAGGCACAGAAGGTGG - Intergenic
1103939000 12:124491873-124491895 CCCTGAGGATGGAGAGAATGAGG + Intronic
1104399651 12:128464971-128464993 CACAGAGAGGGGAGAGAAGGAGG + Intronic
1104645757 12:130496263-130496285 GAATGAGAATCAAGAGAAAGGGG - Intronic
1104766743 12:131334828-131334850 AAATGTGGATGGTGAGAAGGGGG + Intergenic
1105771174 13:23613500-23613522 AAAGGAGAATGCAGAGAAAGAGG - Intronic
1105805860 13:23951274-23951296 CCACGAGAATGCAGGGAAGGAGG - Intergenic
1105894981 13:24709860-24709882 CAATGAGCATGGAGAGAATCAGG - Intronic
1105941797 13:25154212-25154234 CAAATGGAATGGAAAGAAGGAGG - Intergenic
1106562210 13:30856732-30856754 CCACAAGAAGGGAGAGAAGGAGG - Intergenic
1106653492 13:31717384-31717406 CATTGAAAATGAAGAGAAGTTGG - Intergenic
1106891526 13:34251210-34251232 CAATGAGATGGGAGGAAAGGTGG + Intergenic
1107159632 13:37211041-37211063 AAAAGAGAATGGAGATTAGGGGG + Intergenic
1107252525 13:38381065-38381087 GAATGAGGCTGGAGAGTAGGTGG + Intergenic
1107282450 13:38752214-38752236 CAAAAAGGAAGGAGAGAAGGAGG - Intronic
1107353037 13:39536273-39536295 GAAAAAGAATGCAGAGAAGGAGG + Intronic
1107653856 13:42572463-42572485 CAAGGAGCAGGGAGAGAATGAGG + Intronic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1107842602 13:44474694-44474716 AAATAAGAATGGAGGGAAGAAGG + Intronic
1108140474 13:47415915-47415937 CAAAGAGAATGGACAGGAGATGG + Intergenic
1108629288 13:52265518-52265540 TAATGAGAATGGACACAGGGAGG + Intergenic
1108656766 13:52540961-52540983 TAATGAGAATGGACACAGGGAGG - Intergenic
1108707382 13:53001919-53001941 CAAAGAGAATATACAGAAGGGGG - Intergenic
1109085683 13:57968639-57968661 CAATGAGAATCAAGCGAAAGAGG + Intergenic
1109479244 13:62927933-62927955 CATTGAGATTGGATAGAGGGAGG + Intergenic
1109655424 13:65384513-65384535 CACTGAGAATGGATTGAGGGAGG - Intergenic
1109852873 13:68090117-68090139 CCATCAGAATTCAGAGAAGGAGG - Intergenic
1109877964 13:68430250-68430272 CAGTTAGAAAGGACAGAAGGAGG + Intergenic
1110410315 13:75197766-75197788 GAAAGAGGATGAAGAGAAGGAGG + Intergenic
1110515819 13:76411400-76411422 CAAGGAGAAGGGGGAGGAGGAGG + Intergenic
1110592018 13:77274483-77274505 GAAAGGGAAGGGAGAGAAGGAGG + Intronic
1111024171 13:82497602-82497624 CAATGAGAATGGGGAGAAATTGG - Intergenic
1111211043 13:85080780-85080802 CAGAGAGATGGGAGAGAAGGAGG + Intergenic
1111466160 13:88614102-88614124 TAATAAGAAGGTAGAGAAGGAGG + Intergenic
1111517411 13:89352614-89352636 CACTGAAAATGGAGAACAGGAGG - Intergenic
1111612961 13:90628281-90628303 AAATGAGAATGGACACAAGCAGG + Intergenic
1111841665 13:93457021-93457043 GAATGAGAGCGGAGTGAAGGAGG - Intronic
1111937108 13:94568952-94568974 CAATGAGGATGTAGAGAAATTGG - Intergenic
1112132275 13:96537205-96537227 GAATGAGAACGAAGAGAAAGAGG + Intronic
1113073444 13:106445175-106445197 GAATGAGGATGGAGAAATGGTGG - Intergenic
1113389938 13:109885840-109885862 CAAGGAGGATGAAGAGATGGGGG + Intergenic
1113649245 13:112023826-112023848 AAATGAGAATCAAGAGAAGGAGG + Intergenic
1114040424 14:18673239-18673261 GAAAGAGAAAGGAGGGAAGGAGG + Intergenic
1114045462 14:18871756-18871778 GAAAGAGAAAGGAGGGAAGGAGG + Intergenic
1114118750 14:19647712-19647734 GAAAGAGAAAGGAGGGAAGGAGG - Intergenic
1114337250 14:21703278-21703300 CAATGAGAATGGAGAGGAAAGGG + Intergenic
1115353789 14:32425591-32425613 GAAAGAGAAAGGAGGGAAGGAGG + Intronic
1115497322 14:34019188-34019210 GAATTAGAAGGGAGAGAAGAAGG + Intronic
1115869060 14:37779244-37779266 CATTGAGAATGAACAGAAAGAGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1115908806 14:38232328-38232350 CACTGAAAATGGAGTGGAGGCGG + Intergenic
1116497139 14:45574779-45574801 GAAGGAGATTGGAGAGAGGGAGG + Intergenic
1116649141 14:47566783-47566805 CATTGAGAGTGGACAGAGGGAGG - Intronic
1116877214 14:50123997-50124019 TAATTAGAATGGAGATGAGGAGG + Intronic
1117002684 14:51387025-51387047 GAAAGGGAAGGGAGAGAAGGAGG - Intergenic
1117169756 14:53081899-53081921 GAAGGAGAAGGGAGAGGAGGGGG + Intronic
1117294072 14:54362863-54362885 GCATGGGAATGGACAGAAGGAGG + Intergenic
1117397590 14:55326261-55326283 TAATGTGAATGGGGAGAAAGGGG - Intronic
1117784785 14:59271318-59271340 CAATGAGAAGGTAGTGATGGTGG + Intronic
1118073399 14:62271124-62271146 GAAAGAGGATGGAGAGAGGGAGG - Intergenic
1118114663 14:62761865-62761887 CATTGAGAATGGATGGAGGGAGG + Intronic
1118646683 14:67847141-67847163 CAATGAGAATGGATGGAGGGAGG - Intronic
1118650492 14:67887461-67887483 CAATGAGAAGGAAGAAAAGGAGG - Intronic
1118906165 14:70024972-70024994 TAAGGGGAATGGAGAGAAGTGGG + Intronic
1119733376 14:76965296-76965318 AAAGAAGAATGGAGAGAAGTGGG - Intergenic
1120147292 14:80992445-80992467 CAATGAAAATGGAAAGAAGAAGG - Intronic
1120227041 14:81802316-81802338 CAAAGAGAATGAAGAGACAGAGG - Intergenic
1120234106 14:81870945-81870967 CAATCAGAATGGATACGAGGTGG + Intergenic
1120474060 14:84964554-84964576 CAATTAGAAGGAAGAGGAGGAGG - Intergenic
1121223071 14:92300916-92300938 TAATGAGAGTGGAAAGAAGATGG + Intergenic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1121849006 14:97202282-97202304 CAGTGAGAATGAAGAGGGGGCGG + Intergenic
1121871418 14:97411576-97411598 CTTTGAGAAGAGAGAGAAGGGGG - Intergenic
1122027989 14:98891654-98891676 GGATGAGAGTGGGGAGAAGGTGG - Intergenic
1122383466 14:101327514-101327536 CAATGAGAATACAGAGCAGAAGG + Intergenic
1122653899 14:103244130-103244152 AGGTGAGAAGGGAGAGAAGGGGG + Intergenic
1122956232 14:105072818-105072840 CAATGAGAATGGTGTGCAGCTGG + Intergenic
1123894964 15:24819531-24819553 CAATGAGAATTGATAGAATTTGG + Intergenic
1124854897 15:33378231-33378253 CAAATAGAATGGGAAGAAGGTGG - Intronic
1125362314 15:38877047-38877069 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1125451638 15:39814195-39814217 AAAAGAGAATGAAGAGAAAGAGG - Intronic
1125702133 15:41696060-41696082 CAATAAGACTGGAGAGAGAGAGG - Exonic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1126297134 15:47152692-47152714 CAAGGAGACTGGAGAGACAGGGG - Intergenic
1127692525 15:61412136-61412158 CAAGGAGAATGGAGAAACAGCGG + Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128365001 15:66993313-66993335 GAAAGAGAAGGGAGGGAAGGAGG + Intergenic
1129521480 15:76189218-76189240 GAAAGAGAAAGGAGAGAGGGAGG + Intronic
1129559565 15:76552411-76552433 CATTGAGAGTGGATAGATGGAGG + Intronic
1129596205 15:76966416-76966438 AACTGTGAATGGAGGGAAGGGGG + Intergenic
1129913849 15:79250552-79250574 GAATGAAAATGGGGAGAAGAGGG - Intergenic
1130042546 15:80417535-80417557 AAAGGAGAAGGAAGAGAAGGAGG - Intronic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130175096 15:81559837-81559859 CATTGAGAGTGGACAGAGGGAGG - Intergenic
1130332555 15:82933554-82933576 CTGTGAGAATGATGAGAAGGTGG - Intronic
1130615667 15:85404899-85404921 CAATGATAATAGCTAGAAGGAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131150060 15:90042224-90042246 CAAGGAGGCTGGAGAGAAGGGGG - Intronic
1131208972 15:90476764-90476786 CAAGGAGAAGAGAGAGAAGTTGG + Exonic
1131418777 15:92285791-92285813 CACTTAGATGGGAGAGAAGGTGG - Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133069142 16:3234414-3234436 AAAAGAGAAAGGAAAGAAGGAGG + Intronic
1133089828 16:3395453-3395475 GAATGAGAACTGAGTGAAGGGGG - Intronic
1133112105 16:3554196-3554218 GAGGGAGAAGGGAGAGAAGGGGG + Intronic
1133853011 16:9523914-9523936 CAATGAGAAAAGAGAGGAGAAGG - Intergenic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134528075 16:14959994-14960016 AAATGAGAATGGAGAGAGGCTGG + Intergenic
1135147513 16:19975405-19975427 GAATGAGAATGGAGAAAAAAAGG - Intergenic
1135392011 16:22101601-22101623 GAATGAGAATCAAGAGAAAGGGG + Intronic
1135592527 16:23714549-23714571 CAAAGAGGACGGGGAGAAGGTGG - Intergenic
1135931422 16:26740782-26740804 GAATGAGAACTGAGAGAAAGAGG + Intergenic
1137467192 16:48720497-48720519 CATTGAGGAAGCAGAGAAGGTGG + Intergenic
1137873349 16:51971875-51971897 CAATGAGGAGGAAGAGAGGGTGG - Intergenic
1138127788 16:54453045-54453067 CAAGGAGAATGGAGTGAACCCGG + Intergenic
1138148056 16:54629888-54629910 CAATGAGGATGAGGAGAAGGAGG - Intergenic
1138786520 16:59852938-59852960 CATTGAGGAGGGAGAAAAGGAGG + Intergenic
1138933064 16:61685124-61685146 AATTGAGAATAGAGAGAAGTTGG + Intronic
1139426831 16:66885727-66885749 CAATGAGTATGGGGAGATGGAGG + Exonic
1139482786 16:67239921-67239943 GAAGGGGAATGGAGAGAAGATGG + Intronic
1139973304 16:70789957-70789979 CAAGGAGACAGGAGAGGAGGTGG - Intronic
1140565599 16:76037494-76037516 GAATGAGAATTGAGCGAAGGGGG + Intergenic
1141265567 16:82493877-82493899 CAAAGAGGAAGGAGAGAAGAGGG - Intergenic
1141302689 16:82832435-82832457 GAAGGAGGAAGGAGAGAAGGAGG - Intronic
1141614572 16:85202987-85203009 CAAGGAGGAGGGGGAGAAGGGGG - Intergenic
1142520231 17:499357-499379 CAAGCAGAATGGAAAGCAGGCGG - Intergenic
1143042973 17:4053033-4053055 CAGTGAGAATGAACAGAAGTGGG - Intronic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143501693 17:7343122-7343144 GAGTGAGATGGGAGAGAAGGGGG + Intronic
1144053603 17:11518851-11518873 AAAGGAGAAGGGAGAGTAGGAGG - Intronic
1144380274 17:14688143-14688165 CAAAGACAATTGAGAGATGGAGG + Intergenic
1145797042 17:27661581-27661603 CAATGAGGAAGGAGAGGAAGTGG + Intergenic
1145811399 17:27766256-27766278 CAATGAGGAAGGAGAGGAAGTGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146250615 17:31339905-31339927 CCAGGACAATGGAGGGAAGGTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146842061 17:36163140-36163162 CAATGAGGAAGGAGAGGAAGTGG - Intergenic
1146854369 17:36251099-36251121 CAATGAGGAAGGAGAGGAAGTGG - Intronic
1146870272 17:36374991-36375013 CAATGAGGAAGGAGAGGAAGTGG - Intronic
1146877629 17:36426072-36426094 CAATGAGGAAGGAGAGGAAGTGG - Intronic
1147059600 17:37864657-37864679 CAAGGAGAGTGGTGAGCAGGGGG - Intergenic
1147073153 17:37975615-37975637 CAATGAGGAAGGAGAGGAAGTGG - Intergenic
1147084675 17:38055153-38055175 CAATGAGGAAGGAGAGGAAGTGG - Intronic
1147100622 17:38179119-38179141 CAATGAGGAAGGAGAGGAAGTGG - Intergenic
1148408872 17:47447147-47447169 CAAGGAGAGTGGTGAGCAGGGGG - Intergenic
1149297581 17:55274265-55274287 CAATGAAAATGGAGGTAAGAGGG + Intronic
1149389464 17:56174529-56174551 CAAAGATGATGGTGAGAAGGGGG - Intronic
1149466430 17:56883549-56883571 CAAGGAGAATGAAGAGACTGAGG + Intergenic
1149866972 17:60156539-60156561 CACTGAGCAGGGAGAGAAGGTGG - Exonic
1149919220 17:60640682-60640704 GAGGGAGAAGGGAGAGAAGGAGG - Intronic
1150083563 17:62262166-62262188 CAATGAGGAAGGAGAGGAAGTGG - Intergenic
1150241424 17:63636756-63636778 CAATGAGGAGGAAGACAAGGAGG + Intronic
1150447440 17:65238036-65238058 CAAAGAAAATGGAGAGGAGGAGG - Intergenic
1151141054 17:71992755-71992777 CACTGAGAGTGAACAGAAGGAGG + Intergenic
1151464664 17:74276780-74276802 CAAGGAGATTGAAGAGAATGAGG - Intronic
1151643248 17:75411951-75411973 CAATGAGATTGGAGGTATGGTGG - Intergenic
1151814636 17:76465685-76465707 CAATGAGAAGGAAAATAAGGAGG - Intronic
1152297536 17:79476863-79476885 GAATGAGAAAGGAAAGAAGTAGG + Intronic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1152565129 17:81096965-81096987 GAAGGAGAAAGGAGAGGAGGAGG + Intronic
1153358461 18:4165039-4165061 TAAAAAGAATGGAGAGAGGGTGG + Intronic
1153416190 18:4848612-4848634 AAATGAGCATTCAGAGAAGGTGG + Intergenic
1153682238 18:7511642-7511664 CAATGACAATGGAGATGATGTGG + Intergenic
1153684408 18:7530806-7530828 AAATGCAACTGGAGAGAAGGCGG + Intergenic
1154937366 18:21074951-21074973 CAACGAGAATTCAGAGAATGAGG + Intronic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155148886 18:23106630-23106652 GAGTGAGAATGGAGCTAAGGTGG - Intergenic
1156208037 18:34907120-34907142 GAATGAGAACTGAGTGAAGGGGG + Intergenic
1156240632 18:35250626-35250648 CAATGAGCTTGGAGAGATGAGGG - Intronic
1156365590 18:36423484-36423506 CTCTGAGAATAGAAAGAAGGTGG + Intronic
1156924550 18:42559755-42559777 GAAAGAAAATGGTGAGAAGGAGG - Intergenic
1157099431 18:44716012-44716034 CCAGGAGAAGGGAGGGAAGGTGG - Intronic
1157156217 18:45269022-45269044 CAATGATCATTGACAGAAGGAGG + Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157271074 18:46276782-46276804 AGATGAGAAAGGAGACAAGGAGG + Intergenic
1157514682 18:48302371-48302393 CAGTAAAAAGGGAGAGAAGGTGG - Intronic
1157849628 18:51035884-51035906 GAATGGGAATGGAGTGGAGGAGG + Intronic
1158801039 18:60909657-60909679 CAGTGAGAATGTAGAGAAACAGG + Intergenic
1160029644 18:75247692-75247714 TAATTAGAAGGGAGAGACGGAGG + Intronic
1160269115 18:77367986-77368008 AAATGAGCATGCAGAGAAAGCGG - Intergenic
1161103206 19:2431592-2431614 GAATGAGAATGGGGAGGAAGAGG - Exonic
1161196042 19:2987327-2987349 CCATGACAACGGAGAGGAGGAGG - Intronic
1161520279 19:4720008-4720030 CAATGAGGAGGGGGCGAAGGGGG - Intronic
1161842697 19:6692561-6692583 CCATAAGGATGGAGAGAAGGAGG + Intronic
1161977362 19:7613817-7613839 CCATGGGAATGGAGAGACAGTGG - Intronic
1162516198 19:11149283-11149305 CAAGGAGAGCAGAGAGAAGGTGG + Intronic
1162708608 19:12574681-12574703 AAATGCGAAAGAAGAGAAGGTGG - Intronic
1163397120 19:17070150-17070172 GAAGGAGAAAGGAGAGAAAGGGG - Intronic
1164441812 19:28284861-28284883 GAAGGAGGGTGGAGAGAAGGAGG + Intergenic
1164725853 19:30465168-30465190 GAATGAGAATAGAGGCAAGGTGG - Intronic
1164846455 19:31437068-31437090 GAATGAGAATCGAGCAAAGGGGG - Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1165335314 19:35165811-35165833 CACTGGGAAGGGAGTGAAGGAGG + Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG + Intronic
1166909217 19:46139198-46139220 CATTGAGAGTGGAGTGAGGGAGG - Intergenic
1167030980 19:46960184-46960206 CAGGGCTAATGGAGAGAAGGCGG - Intronic
1167606313 19:50482609-50482631 CACAGAGGCTGGAGAGAAGGCGG - Exonic
1168134574 19:54341863-54341885 GAATGAGAGTGGAGCGAAGGGGG + Intergenic
1168179478 19:54651063-54651085 CACTGAGGGTGGAGAGGAGGGGG - Intronic
1168333889 19:55586008-55586030 CAATGAGGAGGGGGAGACGGTGG - Intergenic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
1168574521 19:57498995-57499017 AAATGAGAATGGGGTGAAAGAGG + Intronic
926109653 2:10173756-10173778 CAGTGAAATTGGAGAGAACGAGG + Intronic
926346143 2:11947435-11947457 GAATGAGAGCTGAGAGAAGGAGG + Intergenic
926707246 2:15845577-15845599 CAATGAGAGGGGAGAGCTGGGGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927292108 2:21414784-21414806 CAATGAGAATAGTATGAAGGAGG - Intergenic
927457939 2:23273449-23273471 CCCTGAGAATGGATAGATGGGGG + Intergenic
928311389 2:30213430-30213452 CTAAGAGAATGGAGAGGTGGAGG + Intergenic
928602355 2:32915942-32915964 GAAGGAGAAAGGAGAGAAGAAGG - Intergenic
929050129 2:37829426-37829448 TAATGAGAAGGGAGGGAGGGAGG + Intergenic
931265178 2:60654055-60654077 CAAAGAGGAGGGAGAGAAAGTGG + Intergenic
931478978 2:62621003-62621025 CAAGGAGAATGGAAACAAGTTGG - Intergenic
931964034 2:67513862-67513884 TAATGAAAATGAAGAGAAGAAGG + Intergenic
932287107 2:70544507-70544529 CAATTAGAATAGATAGCAGGGGG + Intronic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932445755 2:71780057-71780079 GAGAGAGAATGGAGAGAGGGGGG - Intergenic
932455157 2:71844788-71844810 GAATGAGTGAGGAGAGAAGGAGG + Intergenic
932474912 2:71998662-71998684 CAATGAGAATCAAGTGAAAGGGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932617990 2:73248057-73248079 CACAGAGTATGGAAAGAAGGGGG - Intronic
932633001 2:73362815-73362837 CAATGAGCAGGGACAGGAGGGGG - Intergenic
933058343 2:77702637-77702659 GAAAGAGAAGGGAGAGCAGGAGG + Intergenic
933158702 2:79001390-79001412 CAATAGGAATGAAGAGAAGAGGG - Intergenic
934784399 2:96994460-96994482 CAAAGAGGATGGAGAGCAGAAGG - Intronic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935844892 2:107155153-107155175 CAATGAGAAGGAAGAAGAGGAGG - Intergenic
935860584 2:107324771-107324793 CAATGAGAATTGAAACCAGGAGG - Intergenic
935871484 2:107455583-107455605 CATTGAGAGTGGACAAAAGGAGG + Intergenic
936692764 2:114912606-114912628 CATTGAGAGTGGATAGAAAGAGG + Intronic
936719575 2:115234608-115234630 CAGTGTGCATGGTGAGAAGGTGG - Intronic
936912272 2:117605110-117605132 GTGTAAGAATGGAGAGAAGGGGG + Intergenic
936964247 2:118111800-118111822 AAAAGAGAATGTAGAGAAGCAGG + Intergenic
937308944 2:120889820-120889842 TAATGAGAATGCAGAGAAACAGG + Intronic
937545720 2:123017120-123017142 CAATGAGGATGGGGAGATGTTGG + Intergenic
937668078 2:124509673-124509695 CAATGAATATGGAGAGCAGCAGG - Intronic
938578760 2:132627566-132627588 CAATGAAAATGAAGATAAGAGGG + Intronic
938781424 2:134588287-134588309 CAATAAGAAAGGAGGGAAAGGGG + Intronic
939165967 2:138641736-138641758 CATTGAGCAGGGAGAGGAGGTGG - Intergenic
939566438 2:143791181-143791203 CATTGAGAATGAGGAGAAAGTGG - Intergenic
939569229 2:143820427-143820449 AAAGGAGAAAGGAAAGAAGGGGG + Intergenic
940189375 2:151023542-151023564 CTATGAGGATGCAGAGAAAGGGG + Intronic
940464864 2:154014470-154014492 CACTGAGAGTGGACGGAAGGAGG - Intronic
940842076 2:158595301-158595323 CAATAAGCATGGTGAGAAGTAGG - Intronic
941011133 2:160300361-160300383 CACTGAGGATGGTGATAAGGTGG + Intronic
941505333 2:166336931-166336953 CAAAGAAAGTGGAGAGAAAGGGG + Intronic
941507497 2:166365750-166365772 GACAGAGAATTGAGAGAAGGAGG - Intronic
941724426 2:168845624-168845646 CACTGGGAATGCTGAGAAGGGGG - Intronic
941737515 2:168995393-168995415 TAATGAGAATGGAAATAGGGTGG - Exonic
942119114 2:172759343-172759365 CAATGAGAATGCAGGTAAGTGGG + Intronic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942874341 2:180776060-180776082 GAAAGAAAATGGAGAGAGGGAGG - Intergenic
942967502 2:181914845-181914867 CTTTCAGAATGGAGAGAAGGAGG + Intronic
943157997 2:184209335-184209357 GAATGAGAACAGAGGGAAGGAGG - Intergenic
943288973 2:186043582-186043604 CATTGAGAATGGGCAGAAGGTGG - Intergenic
943409955 2:187534112-187534134 CAGGGAGAATGGAAAGAAGTTGG + Intronic
943453677 2:188075975-188075997 CATTGAGAGTGGACAGAGGGTGG - Intergenic
943493861 2:188593222-188593244 AAAAGAGATTGGAGTGAAGGAGG + Intronic
944302992 2:198145910-198145932 CCATGAGAATGGAGAGGAGAGGG + Intronic
945043299 2:205760615-205760637 GAAGGAGAAAGGAGAGAAGAGGG + Intronic
945044532 2:205770483-205770505 GAATGGGAAAGGAGAGAAGGGGG - Intronic
945273470 2:207964485-207964507 CCATGAGAGTGGAGGGAGGGAGG + Intronic
945401193 2:209385417-209385439 CAAAGAGAGTGGACACAAGGAGG - Intergenic
945430200 2:209755079-209755101 TATTGAGAATGGACAGAGGGAGG + Intergenic
945525883 2:210887741-210887763 CATTGAGAGTGGACAGAGGGAGG + Intergenic
945941234 2:215952982-215953004 CAATGAGATAGGAGAGAGAGAGG - Intronic
946290388 2:218740145-218740167 TGATGAGAATGAAGAGGAGGAGG + Exonic
946299722 2:218815109-218815131 AGATGAGGAGGGAGAGAAGGAGG + Exonic
946794995 2:223341074-223341096 CAAGGATAATGGAGAGATTGGGG - Intergenic
947048882 2:226019714-226019736 GAATGAGAACAAAGAGAAGGGGG + Intergenic
947310346 2:228795135-228795157 CAATTAGAAGGGGGAGAAGCAGG - Intergenic
948127474 2:235575159-235575181 CATTGAGAATAAAGAGATGGTGG + Intronic
948315682 2:237026812-237026834 CATTGGGAATGGAGACCAGGTGG + Intergenic
948664922 2:239528804-239528826 AATTGAAAATGGTGAGAAGGAGG - Intergenic
948787667 2:240361312-240361334 GAAAGAGAAGAGAGAGAAGGAGG + Intergenic
949002992 2:241628099-241628121 CCAGGATAGTGGAGAGAAGGGGG - Intronic
949003003 2:241628133-241628155 TGACCAGAATGGAGAGAAGGGGG - Intronic
1168752113 20:290185-290207 CCGTGAGAGTGGAGAGCAGGTGG + Intronic
1168774916 20:439350-439372 CAAGGATAATGGAGTGCAGGTGG - Intronic
1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG + Intergenic
1169636931 20:7702774-7702796 CAATGAGGAGGGAGAGCAGCAGG - Intergenic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169695611 20:8384119-8384141 CAAGGAGAATGAAAAGAAGCTGG - Intronic
1169848025 20:10016525-10016547 GAATGAGAGCCGAGAGAAGGGGG + Intronic
1170014639 20:11766847-11766869 TAATGTGAATACAGAGAAGGAGG + Intergenic
1170906058 20:20516064-20516086 CAATGGGAGTGGAGAGTAGCAGG - Intronic
1171028285 20:21652860-21652882 CCATCAGAACTGAGAGAAGGAGG - Intergenic
1171303898 20:24088480-24088502 CAGTGAAACTGGAGTGAAGGAGG - Intergenic
1171327869 20:24311553-24311575 CAGTGAGATTAGAGAGGAGGTGG + Intergenic
1172328616 20:34057770-34057792 TAATAAGAATGGAGAGAGGGGGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173292681 20:41728319-41728341 CATTCAGAGTGGACAGAAGGAGG - Intergenic
1173440508 20:43071200-43071222 TAAGGAGAAAGTAGAGAAGGAGG - Intronic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174851469 20:53999524-53999546 CAATGAGAATGGAATGGAAGAGG - Intronic
1175040091 20:56040987-56041009 CAATGAGAATTGACAGAGCGTGG + Intergenic
1175059757 20:56231197-56231219 CAAGAAGAATGCAGAGAAAGGGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175694728 20:61093222-61093244 AAATGAGACTGGAGAGAGGGTGG - Intergenic
1176378629 21:6100531-6100553 CGCTCCGAATGGAGAGAAGGAGG + Intergenic
1177161044 21:17548480-17548502 GAGAGAGAAGGGAGAGAAGGGGG - Intronic
1177275646 21:18909766-18909788 CGATGAGAAGAGAGAGAATGCGG + Intergenic
1177433127 21:21016069-21016091 CAATGAGTATTGAGGGAAGTTGG - Intronic
1177619072 21:23563075-23563097 CATGGAGAATGGAGAAAAGCAGG - Intergenic
1178009994 21:28273733-28273755 CATTGAGAATGGTTAGAAGTGGG - Intergenic
1178043931 21:28673022-28673044 GAAAGAGAAAGGAGAGAGGGAGG + Intergenic
1178791562 21:35705032-35705054 GAAAGAGAAAGGAAAGAAGGAGG + Intronic
1178813579 21:35906629-35906651 CAATGACAATGAGAAGAAGGAGG + Intronic
1179744846 21:43437706-43437728 CGCTCCGAATGGAGAGAAGGAGG - Intergenic
1180463993 22:15594373-15594395 GAAAGAGAAAGGAGGGAAGGAGG + Intergenic
1180714188 22:17860336-17860358 AAATGGAAGTGGAGAGAAGGCGG + Intronic
1181177333 22:21045204-21045226 CAAAGAGAATGTAGGGAGGGTGG - Intergenic
1182352445 22:29706508-29706530 TAATTAAAATGCAGAGAAGGAGG + Intergenic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183002839 22:34875921-34875943 TGATGAGGATGGAGGGAAGGGGG + Intergenic
1183285775 22:36962185-36962207 TAAAGACAATGGAGAGAATGAGG - Intergenic
1183305117 22:37078757-37078779 GAAAGAGAATGAGGAGAAGGAGG + Intronic
1183331043 22:37221713-37221735 CCATGACAATGCAGAGAAGGGGG + Intergenic
1183587967 22:38763959-38763981 TAATGAAAAATGAGAGAAGGTGG - Intronic
1184049712 22:41995299-41995321 CCATGAGAAGGCAGAGAAGTAGG + Intronic
1184250326 22:43256530-43256552 TAATGAGAGGGGAGGGAAGGTGG + Intronic
1184379888 22:44138631-44138653 CACTGAGACTGGATAGGAGGTGG - Intronic
1184428847 22:44429241-44429263 GCAGGAGAATGAAGAGAAGGAGG + Intergenic
1185037058 22:48484879-48484901 GAAGGAGAAGGAAGAGAAGGAGG - Intergenic
949203020 3:1403358-1403380 CAATGACAATGGAAAGAAAATGG - Exonic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
950896455 3:16455980-16456002 GAATGATAATGCAGAGACGGGGG - Intronic
951164601 3:19469880-19469902 CAATGAAGATGGGAAGAAGGTGG - Intronic
951596813 3:24327274-24327296 CAATTAGAAGTGAGAGAATGAGG - Intronic
951620906 3:24601590-24601612 AAATGAAAATGGAGAGGAGGGGG - Intergenic
951632386 3:24736191-24736213 CAATGCTGCTGGAGAGAAGGAGG + Intergenic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
951866672 3:27316274-27316296 GAGTAAGAATGGAGAGAAAGGGG + Intronic
952035163 3:29191548-29191570 TAAAGAGAATGTAGAGAAAGGGG - Intergenic
952050711 3:29381168-29381190 CAATGCCAGTGGAGAGCAGGGGG - Intronic
952141287 3:30481404-30481426 GAATGAGAGTCGAGTGAAGGGGG - Intergenic
952526428 3:34215448-34215470 GCATGAGAATGGAGAGACAGAGG + Intergenic
953052819 3:39361630-39361652 CAAGGAGAATGAAGAAAAGCAGG + Intergenic
953181239 3:40597108-40597130 CACTGAGAGTGCAAAGAAGGAGG - Intergenic
953421965 3:42761224-42761246 CAGTGGGAATGGAGACATGGGGG - Intronic
953546196 3:43865240-43865262 AAGAGAGAAGGGAGAGAAGGAGG + Intergenic
953593369 3:44282621-44282643 CTATTAGTATGGGGAGAAGGTGG - Intronic
953826904 3:46261484-46261506 AGATAAGAATGGAGAGGAGGAGG + Intronic
954674081 3:52306139-52306161 CAAGGAGAAGGGAAAGGAGGTGG + Intergenic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955252161 3:57294587-57294609 GAATGAGAAGGGAGGGAAGAAGG + Intronic
955603543 3:60673997-60674019 AAATGAGGATAGAGAGAATGAGG - Intronic
955731899 3:61996046-61996068 CAGGAAGAAGGGAGAGAAGGGGG - Intronic
955765418 3:62339466-62339488 GAATGAGAATCAAGTGAAGGGGG - Intergenic
956684205 3:71809365-71809387 CCATGAAAATAGAAAGAAGGAGG + Intergenic
956796364 3:72722204-72722226 AAAGGAGAAGGGAGGGAAGGAGG + Intergenic
957640773 3:82850350-82850372 GAATGACAATGAGGAGAAGGAGG - Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
957843877 3:85705164-85705186 AAATAAGAATGAAAAGAAGGGGG - Intronic
957866375 3:86029272-86029294 GAAAGAGAATGGAGAGAGGCTGG + Intronic
957968321 3:87350448-87350470 CAAAGAAAATGCAGAGAAGAAGG - Intergenic
958582660 3:96046113-96046135 GAATGAGAACTGAGTGAAGGAGG + Intergenic
958898192 3:99853911-99853933 CAGTGAGAACTGAGAGCAGGAGG + Intronic
958955527 3:100461867-100461889 CAATGAGAATAGAGGGAATTCGG - Intergenic
959205684 3:103303784-103303806 CAGGGAGAATGGAAACAAGGTGG - Intergenic
959239774 3:103775550-103775572 AAAGGAGGAAGGAGAGAAGGAGG - Intergenic
959349410 3:105242393-105242415 CAAAGAAAATGGAGAGGTGGTGG - Intergenic
959394967 3:105825376-105825398 GAAAGAGAAAGAAGAGAAGGGGG + Intronic
959445722 3:106436209-106436231 GAAAGAGAAAGGAGGGAAGGAGG + Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960580459 3:119274010-119274032 GAAAGAGAAGGGAGAGAAGTGGG - Intergenic
961305511 3:125957081-125957103 CAATGAGAATGGACACAGGGAGG - Intergenic
961513210 3:127416498-127416520 CAATGAGAAGGGGGAGGAGGAGG + Intergenic
961933239 3:130555388-130555410 CATTGAGAATGGACAGAGGGAGG - Intergenic
962001835 3:131305861-131305883 CATTGAGAGTGGATAGAGGGAGG - Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962263300 3:133928381-133928403 AGATGAGAAGAGAGAGAAGGTGG + Exonic
962350478 3:134652152-134652174 CAGTGATAAGGGTGAGAAGGTGG - Intronic
962710757 3:138083767-138083789 GAATGAAGATGGGGAGAAGGGGG + Intronic
962853334 3:139324184-139324206 CAATGAAAATGAACACAAGGTGG - Intronic
962873555 3:139518790-139518812 CACTGAGAATGGGGCTAAGGTGG + Intronic
963093631 3:141511368-141511390 CAAAGAGAAGGAAGAGAAGGTGG + Intronic
963141690 3:141950997-141951019 CACTGAGCATGGTGAGGAGGAGG - Intergenic
963414315 3:144975178-144975200 GAATGAGAAGGGGGAGGAGGAGG - Intergenic
963442587 3:145357860-145357882 AAGTGAGAAGAGAGAGAAGGGGG + Intergenic
963519446 3:146346064-146346086 CATGGAGAATGGAGAAAAGCAGG - Intergenic
963841692 3:150114297-150114319 CCAAGAGAATGCAGAGGAGGAGG + Intergenic
964004004 3:151808566-151808588 TAATGAGAGAGGAGAGAAGTGGG - Intergenic
964172839 3:153790970-153790992 CAATGAGAATGTACACAGGGAGG - Intergenic
964387176 3:156160441-156160463 CAAGGAGAAAGAGGAGAAGGAGG - Intronic
964669975 3:159214358-159214380 CAGTGAGGATCTAGAGAAGGTGG - Intronic
964882735 3:161442381-161442403 GAATGACAATTGAGAGAAAGGGG - Intergenic
965065715 3:163845675-163845697 CAATGAAAATTGAGAGTAAGGGG - Intergenic
965075333 3:163968235-163968257 CATCGAGAGTGGATAGAAGGAGG + Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965598220 3:170428620-170428642 AAATGAGAAGGAGGAGAAGGGGG - Intronic
965811318 3:172593575-172593597 CATGGAGAATGGAGAAAAGCAGG - Intergenic
966032244 3:175364182-175364204 GAATGAGAGAGGAGAGATGGTGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967337451 3:188360407-188360429 CAAAGAGGAGAGAGAGAAGGAGG - Intronic
967442335 3:189523295-189523317 GAATGAGAATGGTGAAAAGTAGG - Intergenic
967539067 3:190643385-190643407 AAATGAGAAAGGAAGGAAGGTGG + Intronic
967627128 3:191699746-191699768 AAAGGAGGAGGGAGAGAAGGAGG + Intergenic
967652573 3:192004658-192004680 CAATGAGAATGCAAAGAAAATGG - Intergenic
967992641 3:195142856-195142878 CAAAGGGAAGAGAGAGAAGGAGG - Intronic
968082019 3:195853092-195853114 CACAGAGACTGAAGAGAAGGAGG + Intergenic
968317640 3:197737466-197737488 CCAGGAGAAAGAAGAGAAGGTGG + Intronic
968664632 4:1814444-1814466 CAAAGAGAAGGCAGAGAAGGAGG - Exonic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
968953839 4:3708340-3708362 GAGTGAGAATGGAGAGAGGCGGG - Intergenic
969248291 4:5950371-5950393 TAATATGAGTGGAGAGAAGGGGG + Intronic
969836937 4:9850054-9850076 CATTGAGAGTGGATAGAGGGAGG + Intronic
969843651 4:9902161-9902183 AAAGGGGAATGGAGAGACGGGGG - Intronic
970054012 4:11950695-11950717 GAATGAGAATGGGAAGAAGCTGG + Intergenic
970221747 4:13818885-13818907 CAATGGGAATGTGGTGAAGGTGG - Intergenic
970415152 4:15849532-15849554 CACTGAGCATGAAGAGGAGGAGG - Exonic
970703435 4:18770866-18770888 CATTGAGAATGGACAAAAGGAGG + Intergenic
971538067 4:27779813-27779835 CAAGGAGATTGGAGTTAAGGAGG + Intergenic
971724477 4:30292370-30292392 CAATGCAAATGAAGAGAATGAGG + Intergenic
971729730 4:30361668-30361690 CATTGTAAATGGATAGAAGGAGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972267134 4:37472238-37472260 CTCTGAGAATGAAGAGAATGAGG - Intronic
972388187 4:38587761-38587783 AAAGGAGAATGGAGAGTGGGTGG + Intergenic
974249362 4:59363670-59363692 CAAGGAGAATGGAGAAAAACAGG - Intergenic
974271644 4:59657479-59657501 CAAAGAGAATGGAAACAAGCTGG + Intergenic
974543791 4:63274825-63274847 CATTGAGAATGGAGGGAGGGAGG + Intergenic
974621360 4:64360635-64360657 CATTGAGTATGGACAGAGGGAGG + Intronic
974631459 4:64494788-64494810 GAATGAGAATGAAGTGAAAGGGG + Intergenic
975976095 4:80098342-80098364 TAATGAGAATTTAGAGAAAGAGG - Intronic
976375326 4:84339259-84339281 CATTGAGAGTGGACAGAGGGAGG - Intergenic
976600862 4:86935944-86935966 GAATGAGAGGGGAGAGAAGGTGG + Intronic
976655649 4:87486258-87486280 CAATGAGAATGAAGACAAAATGG - Intronic
976777205 4:88719707-88719729 GAATGAGAAGGAAGAGAAGGAGG - Intergenic
977277721 4:94998892-94998914 CAAATAAAATGGAGAGAAAGGGG - Intronic
977601617 4:98939404-98939426 CAGTGAGAATGAAGAGGAGAGGG - Intergenic
977858144 4:101920964-101920986 GGAAGAGAAAGGAGAGAAGGAGG + Intronic
978018054 4:103772949-103772971 GAAGGAGAAAAGAGAGAAGGGGG - Intergenic
978084704 4:104636431-104636453 CAATGAGATTGGAGATAAGAAGG - Intergenic
979041296 4:115800257-115800279 CAGGGAGACAGGAGAGAAGGGGG - Intergenic
979216703 4:118173311-118173333 CAATGACAGTGGAAAGAATGTGG - Intronic
979437084 4:120705962-120705984 CAATGAGAATTTAGAGATGGTGG + Intronic
979680380 4:123453281-123453303 CAATGAGAATGGAGAGATTGTGG + Intergenic
979735206 4:124074126-124074148 CAAGGAGAATGGAAACAAGCTGG + Intergenic
979864819 4:125740778-125740800 CAACAACAATGGAGAGGAGGTGG - Intergenic
980164178 4:129204630-129204652 CAATGAGAAAGCAGAGTAGGAGG + Intergenic
980312375 4:131148110-131148132 CAATGAAAAATGAGAGAAGAGGG + Intergenic
980420070 4:132547417-132547439 CAAGGAGAAGGAAGAAAAGGAGG - Intergenic
980532313 4:134071270-134071292 CACTGAGAGTGGACAGAGGGAGG - Intergenic
980754158 4:137135870-137135892 GAATGAGTGTGGAGGGAAGGGGG - Intergenic
981101840 4:140837583-140837605 CAAACAGAATGTAGAGGAGGGGG - Intergenic
981282287 4:142972179-142972201 AAGGGAGAAAGGAGAGAAGGAGG + Intergenic
981401743 4:144321784-144321806 CATTGAGAATGGACAGAAGGAGG + Intergenic
981407063 4:144384620-144384642 GAATGAGAACTGAGTGAAGGGGG + Intergenic
981466179 4:145075538-145075560 CATTGAGAGTGGACAGAGGGAGG + Intronic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
982048190 4:151470682-151470704 CAATGAGAATAAAGAGAAGAGGG + Intronic
982310189 4:153976283-153976305 GAATGAGGCTGGAGAGAAGTTGG - Intergenic
982565173 4:156976934-156976956 TGATGAGAAAGAAGAGAAGGTGG - Intergenic
982602248 4:157467476-157467498 CAATGGGAAAAGAGAGAGGGAGG - Intergenic
982906963 4:161086885-161086907 CAAACAGAATGTAGAGGAGGGGG + Intergenic
983249490 4:165327912-165327934 GAAGGAGACTGGAGTGAAGGTGG + Intronic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984070402 4:175103600-175103622 CGATGAGAAGGGAGAGGAGGTGG + Intergenic
984462127 4:180051854-180051876 CACTGAGAATGTAGAGAAACTGG + Intergenic
984865674 4:184278231-184278253 GAATGAGTTTGGAGTGAAGGGGG - Intergenic
985139663 4:186826863-186826885 GAATGAGAAGGCAGAGGAGGTGG - Intergenic
985208959 4:187571776-187571798 CAATGGTAATGGAAAGAAAGAGG + Intergenic
985230041 4:187805818-187805840 TAGTGAGAATGCAGAGAAGAGGG + Intergenic
985443842 4:190008068-190008090 CAGGGAGAAAGGGGAGAAGGTGG + Intergenic
986095828 5:4553410-4553432 CACTGAGAAGGGAGCAAAGGTGG - Intergenic
986180240 5:5386279-5386301 CAATGAGAACGAAGTGAATGAGG + Intergenic
986289852 5:6391010-6391032 GAATGAGAATCGAGTGATGGGGG - Intergenic
986495735 5:8340087-8340109 CATTGAGAATGGACAGAGGGAGG + Intergenic
986909022 5:12531994-12532016 CATTGAGAGTGGACAGGAGGAGG + Intergenic
986985348 5:13494397-13494419 CATTGAGAGTGGACAGATGGAGG - Intergenic
987018267 5:13843406-13843428 CCATGAGCAAAGAGAGAAGGGGG - Intronic
987362646 5:17121125-17121147 CAAAGAGAATGGAGAGAAGGTGG + Intronic
987759850 5:22147699-22147721 CAATGAGAGTCAAGAGAAAGGGG + Intronic
987794194 5:22606537-22606559 GAATGAGTGTGGAGTGAAGGAGG - Intronic
987851455 5:23361113-23361135 GAATGAGAACCGAGTGAAGGGGG + Intergenic
988974974 5:36506270-36506292 AGAAGAGAATGGAGGGAAGGGGG + Intergenic
989144345 5:38234045-38234067 GAATGAGAACAGAGTGAAGGGGG - Intergenic
989842531 5:46097555-46097577 GAATGAGAAAGGAGTAAAGGAGG - Intergenic
990251024 5:53915134-53915156 CAAGGACAAGGGAGGGAAGGAGG - Intronic
990798756 5:59575067-59575089 CAATGAGACTAGAAAGGAGGAGG + Intronic
991513208 5:67403420-67403442 CAGTGAGAATGGAGAAAAAGGGG - Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
991894582 5:71381131-71381153 CAATGAGAGTCAAGAGAAAGGGG + Intergenic
992180558 5:74193255-74193277 CAAGGAGAAAGGAGAGACAGAGG + Intergenic
992736835 5:79730199-79730221 CAGTGTCAAAGGAGAGAAGGAGG + Exonic
993477970 5:88388507-88388529 CAATGAGAAAGAAGGGAAGTGGG + Intergenic
993859359 5:93115940-93115962 CAGAGAGAATGGAAAGCAGGAGG + Intergenic
994589300 5:101754077-101754099 CAATGAGATTGGACCTAAGGTGG - Intergenic
994794851 5:104283266-104283288 CAATATGAATGAAGAGAAAGTGG + Intergenic
994946937 5:106406592-106406614 GAATGATAATTAAGAGAAGGAGG + Intergenic
995349625 5:111160072-111160094 GAATGAGAACTGAGTGAAGGGGG + Intergenic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
996075226 5:119185132-119185154 CAAGAAGAAAGGAGAGATGGGGG - Intronic
996135318 5:119834314-119834336 TAATCAGAGTGGAGAGAAGATGG - Intergenic
996191655 5:120550748-120550770 CAATGAGAAAGGAAGGAATGAGG - Intronic
996482478 5:123990640-123990662 CTATGAAAATAGAAAGAAGGGGG + Intergenic
996813495 5:127546038-127546060 CAAAGAGAAGGGAGAGAAATGGG - Intronic
997697223 5:135871435-135871457 CAAAGACAGGGGAGAGAAGGTGG - Intronic
998004167 5:138646354-138646376 CAGTGAGGATGGAGAGAGAGCGG - Intronic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
999016004 5:148106159-148106181 GAATAGGAGTGGAGAGAAGGAGG - Intronic
999041804 5:148421999-148422021 CAATGGGAAAGGAGAGATGTAGG - Intronic
999089305 5:148921359-148921381 GAATGTGGAAGGAGAGAAGGAGG + Intergenic
999132549 5:149295596-149295618 GAGGGAGAATGGAGAGAAAGAGG + Intronic
999149088 5:149414944-149414966 GAAAGAGCATGGAGAGACGGAGG + Intergenic
999551555 5:152692934-152692956 CAAGGAGAAGGGAGAGAGAGAGG + Intergenic
999743626 5:154575343-154575365 AAAGGAGAAGGAAGAGAAGGAGG - Intergenic
999912812 5:156223657-156223679 TTATGAGAATGGAGAGCATGGGG + Intronic
999963191 5:156779163-156779185 CAACAAGAAGGGAGAGAAAGAGG + Intergenic
1000008954 5:157213828-157213850 TAATGAGAAGGTTGAGAAGGTGG - Intronic
1000134888 5:158337519-158337541 CATTGAGAATGGACAAAAGGAGG - Intergenic
1000181067 5:158811898-158811920 CAATGAGAATGAACAGGAGAGGG - Intronic
1000232227 5:159326783-159326805 CTATAAGAAGGGAGAGAAGCAGG + Intronic
1000642373 5:163718201-163718223 CATTGAGAATGGATAAAGGGAGG + Intergenic
1001078422 5:168647673-168647695 GAATGAGAATAGAGCGAAGGAGG + Intergenic
1001597420 5:172907105-172907127 GGATGGGAATGGAGAGGAGGAGG - Intronic
1001781679 5:174374189-174374211 CAAGGAGAATGGATTGAAGGAGG + Intergenic
1001837279 5:174843057-174843079 TGAGGAGAATGGACAGAAGGGGG + Intergenic
1002141324 5:177141678-177141700 GAATGAGACTGCAGAGAAAGAGG - Intronic
1002312991 5:178325838-178325860 CACTGGGAATGGAGAGCATGTGG + Intronic
1002462635 5:179383088-179383110 AAATGAGAAAGGAGAGGATGAGG - Intergenic
1002781885 6:373238-373260 AAAGGACAATGGAGTGAAGGTGG + Intergenic
1003028087 6:2576525-2576547 CTATGAGAATGGGGAGAGGCAGG + Intergenic
1003674740 6:8192784-8192806 AAAGGAGAAAGGAGAGAAGGTGG + Intergenic
1003817685 6:9860347-9860369 GAAGGAGAAGGAAGAGAAGGAGG + Intronic
1003839983 6:10109962-10109984 CAATTAGAATGGACAGAATGTGG + Intronic
1004567895 6:16816342-16816364 CACTGAGAATGGGGAGCAGGAGG + Intergenic
1004633531 6:17444893-17444915 CAACGAGAATGAAGGGAATGAGG - Intronic
1004732309 6:18369840-18369862 GGAAGACAATGGAGAGAAGGAGG - Intergenic
1005069298 6:21849733-21849755 CATTGAGTAGGCAGAGAAGGTGG - Intergenic
1005081874 6:21964925-21964947 AAATGGGAATGAAAAGAAGGGGG + Intergenic
1005111920 6:22291652-22291674 GAAAGAGAAAGGGGAGAAGGAGG - Intronic
1005705813 6:28451731-28451753 TAATGAGGATGCAGAGAAAGGGG - Intergenic
1005948621 6:30614545-30614567 TAATGAGAATCGGGGGAAGGTGG - Intronic
1006552274 6:34834420-34834442 CATTGTGAAGGGAGAGAATGGGG + Intronic
1006765879 6:36506292-36506314 CTATGAAAATGGAGAAAAGGTGG + Intronic
1006779502 6:36622812-36622834 AAATGACAATGGAGTGAGGGGGG + Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008148113 6:47916520-47916542 AATTGGGAATGGAGATAAGGGGG - Intronic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008581208 6:52908981-52909003 CAAAGAGAACAAAGAGAAGGAGG + Intronic
1008635700 6:53408357-53408379 CAGAGAGAGGGGAGAGAAGGTGG + Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009032740 6:58080577-58080599 CATTGAGAGTGGATAGAGGGAGG + Intergenic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009372212 6:62919650-62919672 AAATGAGAATAGAAAGAATGAGG - Intergenic
1009860065 6:69317311-69317333 GAAGGAGAAAGGAGAGGAGGAGG + Intronic
1009962618 6:70542035-70542057 AAGTGAGAATGGGGAGAAGGGGG - Intronic
1009973123 6:70645621-70645643 AAATGAGAACAGAGAGAGGGTGG + Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010389666 6:75322366-75322388 AGAAGAGAATGGAGAGGAGGTGG - Intronic
1010643236 6:78356283-78356305 AAAAGAGAAGGAAGAGAAGGAGG - Intergenic
1010757386 6:79682207-79682229 AAATGAGAATGGGAAAAAGGGGG + Intronic
1011239022 6:85250858-85250880 TCAAAAGAATGGAGAGAAGGAGG + Intergenic
1011557444 6:88585753-88585775 CCATGAGAATGAAGAGAGGATGG - Intergenic
1011738129 6:90333035-90333057 GAATGAGAGTTGAAAGAAGGCGG + Intergenic
1011784351 6:90827176-90827198 GAATGAGAACTGAGCGAAGGGGG - Intergenic
1011918522 6:92541335-92541357 GAAACAGAATGGAGAGAAAGAGG + Intergenic
1011935292 6:92769652-92769674 AAATGAGAAAGGAGAGAAAAGGG + Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1012243915 6:96904912-96904934 AAATGGGAATGGAGAGCAAGGGG - Intergenic
1012624414 6:101389720-101389742 TAAGGAGAATGGAGAAAATGTGG - Intergenic
1012718842 6:102714324-102714346 CACTGAGACATGAGAGAAGGGGG + Intergenic
1012768141 6:103395964-103395986 TAATGAGAATGGAGCAAAGGAGG - Intergenic
1012791643 6:103705816-103705838 CCATGAAGATTGAGAGAAGGTGG + Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1013732209 6:113181779-113181801 CATTGACAATGGAGAGAATAGGG + Intergenic
1014422121 6:121259605-121259627 CAAGGAGAATGGAAAGGATGTGG + Intronic
1014717475 6:124883323-124883345 GGATGAGAATGGAGAGAAAGAGG - Intergenic
1014804906 6:125818542-125818564 AGAGGAGAATGGAGAGAAGAGGG + Intronic
1015022733 6:128495890-128495912 CATGGAGACTGGAGAGAATGCGG - Intronic
1015405105 6:132828017-132828039 TAATGATAATAGAGACAAGGTGG - Intergenic
1015706493 6:136093688-136093710 CCATGAGCAGAGAGAGAAGGGGG + Intronic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1016003556 6:139066915-139066937 AAAGGAAAATGGAGAGAAGGAGG - Intergenic
1016080919 6:139854733-139854755 CAATAAGGATTCAGAGAAGGGGG + Intergenic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016237448 6:141886244-141886266 CATTGAGAGTGGACAGAAGGAGG + Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016569804 6:145498663-145498685 CAGGGAGAATGGAGAAAAGCAGG - Intergenic
1016622294 6:146125697-146125719 AACTCAGAATGGAGAAAAGGAGG - Intronic
1016838242 6:148501151-148501173 AAATGGCAATGGAGGGAAGGTGG - Intronic
1016850004 6:148609141-148609163 CAATGGCAATGCAGAAAAGGTGG - Intergenic
1017192479 6:151668914-151668936 CAAGGAGAATGGAGAGCACTTGG + Intronic
1017403503 6:154091564-154091586 GGATGAGAATGGAGGGAAGAGGG + Intronic
1017504013 6:155051034-155051056 CAAAGGGATTGGAAAGAAGGTGG + Intronic
1017602618 6:156100250-156100272 CAATGAGTATGGAAAGGAGGGGG - Intergenic
1018210182 6:161473857-161473879 AAATAAGAAAGGAGAGCAGGTGG + Intronic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018560164 6:165093685-165093707 CAAAGAAAATGGAAAGAAGAAGG + Intergenic
1018606574 6:165603728-165603750 TATTGAAAATGGAGAGAAAGGGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019120412 6:169799464-169799486 CAATGAGAATGAAGACGAGGCGG + Intergenic
1020161869 7:5779520-5779542 CGCTGAGAAGGGAGAGAAGCGGG - Intronic
1020222561 7:6251357-6251379 TAATGAGGCAGGAGAGAAGGAGG + Intronic
1020566323 7:9800506-9800528 CAATGGTAGTGGGGAGAAGGAGG - Intergenic
1020987709 7:15156736-15156758 CACTGAGAGTGGACAGAGGGAGG - Intergenic
1021431719 7:20567263-20567285 CCAAGAGTTTGGAGAGAAGGGGG + Intergenic
1021986820 7:26105353-26105375 CAGGGAGAAGGGAAAGAAGGAGG - Intergenic
1022796754 7:33737819-33737841 AAATGAGAAAGAAGAGATGGGGG - Intergenic
1023688595 7:42763161-42763183 GAATGAGAACCGAGCGAAGGGGG + Intergenic
1023785747 7:43705962-43705984 CATTGAGAGTGGACAGAGGGAGG - Intronic
1024003801 7:45210684-45210706 GAAAGAGGATGGAGAGAAGGTGG - Intergenic
1024089816 7:45926092-45926114 AGATAAGAATGGAGAAAAGGAGG - Intergenic
1024507008 7:50170363-50170385 GAAAGGGAAAGGAGAGAAGGAGG + Intergenic
1026245396 7:68615174-68615196 GAAGGAGAAGGAAGAGAAGGAGG + Intergenic
1026919383 7:74144158-74144180 AAATGAAAAAGGAGGGAAGGTGG - Intergenic
1027279116 7:76592849-76592871 GAATGAGAACTGAGTGAAGGGGG + Intergenic
1027306339 7:76901843-76901865 CACTAAAAATGGAGAGGAGGAGG + Intergenic
1027411106 7:77918740-77918762 TAAAGAGGATGGAGAGAGGGAGG - Intronic
1027928588 7:84500417-84500439 GAATGAGAACCAAGAGAAGGGGG + Intergenic
1027985336 7:85280839-85280861 GAATGAAAATGAACAGAAGGAGG + Intergenic
1027990887 7:85359847-85359869 GAATGAGAGTGAAGTGAAGGGGG - Intergenic
1027991522 7:85369064-85369086 CATTGAGAGTGGATGGAAGGAGG - Intergenic
1028213474 7:88103074-88103096 CTATGAAAATTCAGAGAAGGAGG + Intronic
1028244882 7:88465082-88465104 CAATGAGAATGCAAAGAAAGGGG - Intergenic
1028469259 7:91186484-91186506 CAATGATAATGGGGAGAAGTTGG - Intronic
1028605963 7:92656107-92656129 GAAAGAGAAGGAAGAGAAGGAGG + Intronic
1028976800 7:96923757-96923779 AAATGAGAATAGAGAGGAAGGGG - Intergenic
1029214330 7:98934978-98935000 GGATGTGAATGAAGAGAAGGGGG + Intronic
1029448544 7:100627924-100627946 CAATGAGACTTGTCAGAAGGGGG + Exonic
1029645157 7:101850353-101850375 AAATGAGAGTGGGGAGAAGTGGG - Intronic
1029878409 7:103779166-103779188 CCATGAGAGTCAAGAGAAGGAGG + Intronic
1029939771 7:104467842-104467864 GAAAGAGAAGGAAGAGAAGGAGG - Intronic
1029950728 7:104582425-104582447 CAAAGAGATTGAAAAGAAGGGGG - Intronic
1030004972 7:105109079-105109101 TAATGACAATGGGGAGCAGGTGG + Exonic
1030516749 7:110548576-110548598 CAGTAAGAATGGAGAGCAGGAGG - Intergenic
1030889453 7:114981451-114981473 AAAGGAGAAGGGAGAGAAAGAGG - Intronic
1030995326 7:116352641-116352663 CAATGAGAGTTCAGAGAAGTGGG + Intronic
1031711168 7:125047844-125047866 CAGGGAGAATGGAAACAAGGTGG + Intergenic
1031868994 7:127071992-127072014 CAAAGGGAATGGAGAGAAACTGG - Intronic
1032416598 7:131740041-131740063 CACTGAGAAGGGTGAGGAGGAGG - Intergenic
1033178264 7:139147822-139147844 AAAAGAGGATGGAAAGAAGGGGG - Intronic
1033249397 7:139745790-139745812 CAGTGAGCATGCAGAGGAGGAGG - Intronic
1033256587 7:139806781-139806803 AACTGAGAATGGAGCCAAGGGGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033351199 7:140563556-140563578 AAAAGAGAAGAGAGAGAAGGAGG + Intronic
1033394541 7:140961345-140961367 GAAAGAGAAAGGAGGGAAGGAGG - Intergenic
1033462918 7:141563616-141563638 CAATGAGAAGGGGGTGAAGTTGG - Intronic
1033580052 7:142724549-142724571 CAAGGAAAATTTAGAGAAGGAGG + Intergenic
1034063051 7:148110527-148110549 CGTGGAGAATGAAGAGAAGGAGG - Intronic
1034085477 7:148318298-148318320 AAATGAGAATGGCGAGAGGCAGG - Intronic
1034096279 7:148410797-148410819 GAAGGAGAATGAAGAGAAGTGGG + Intronic
1034165328 7:149021103-149021125 CATTGAGGATGAAGAGGAGGAGG - Exonic
1034889767 7:154829508-154829530 GAAGGAAAATGGAGAGAGGGAGG + Intronic
1036059098 8:5294951-5294973 CCATAAGAATAGAGAGAAGGTGG + Intergenic
1036118234 8:5985004-5985026 CAATGAGAATGTAGAGAAATTGG + Intergenic
1037130339 8:15400907-15400929 AGATGAGACTGGAGATAAGGGGG + Intergenic
1037177314 8:15962254-15962276 CATTGAGAGTGGACAGAGGGAGG - Intergenic
1037429663 8:18796410-18796432 CAAAGAGTATGGAAAGGAGGAGG + Intronic
1039396660 8:37231621-37231643 GAAGGAGAAAGGAGAGAGGGAGG + Intergenic
1039742764 8:40397428-40397450 CAATTAGAACAGAGAGAGGGTGG + Intergenic
1039820405 8:41129563-41129585 CAGTGAGAATGAAGAAAAGCAGG + Intergenic
1040079747 8:43274825-43274847 AAATGAGAATGAGGAGGAGGAGG - Intergenic
1040377200 8:46837810-46837832 GAATGAGAATGGAGAATACGAGG + Intergenic
1040408970 8:47135447-47135469 AAGTGAGAATGAAGAGAGGGTGG - Intergenic
1041141641 8:54826326-54826348 CAATGATAATGCAGACAATGTGG - Intergenic
1041248709 8:55914067-55914089 CATGGAGAATGGAGAGGTGGAGG + Intronic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041601167 8:59718774-59718796 CACTGAGTAGGCAGAGAAGGAGG + Intergenic
1042249302 8:66739832-66739854 GAATGAGAACTGAGTGAAGGGGG + Intronic
1042286119 8:67112606-67112628 CTCTGAGAATAGAAAGAAGGAGG - Intronic
1043122607 8:76347561-76347583 AACTGACAATGGAAAGAAGGGGG - Intergenic
1043502200 8:80869511-80869533 CCATTAGATTGGAGAGAAGATGG - Intronic
1043970561 8:86524021-86524043 TAATGTGAATGGAGAGAAAATGG + Intronic
1044443801 8:92250263-92250285 CAAGGAGTATTGAGAAAAGGAGG - Intergenic
1044447684 8:92297467-92297489 CACTGAGAATGAAGAAAAGCAGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045308139 8:100976783-100976805 CAATGGGAGTGGAGACAGGGAGG - Intergenic
1045607915 8:103798940-103798962 CAATGAGATGAGATAGAAGGAGG + Intronic
1045733071 8:105263953-105263975 CAAGGAGAATGGAGAAAAGCAGG - Intronic
1045821438 8:106343066-106343088 GAGTGAGAATGGAGTGATGGAGG - Intronic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1045880683 8:107035321-107035343 GAATGAGAATTGAGCTAAGGGGG - Intergenic
1046334105 8:112760286-112760308 CTAGGAGAATGGGGAGAAGAAGG + Intronic
1046734837 8:117766050-117766072 CAAATAGAATGGAGAGGAAGAGG - Intergenic
1047366112 8:124213094-124213116 GAAAGAGAATGGTGAGAAGGAGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048456902 8:134586734-134586756 CACTGAGACAGGAGTGAAGGGGG - Intronic
1048630661 8:136238880-136238902 CAATGACAATGAAAGGAAGGGGG - Intergenic
1048961549 8:139583818-139583840 CAATGAGGAGGGCGAGAGGGTGG - Intergenic
1048979884 8:139697538-139697560 CATTGTGAATGGAGAGATGGAGG + Intronic
1049460251 8:142723994-142724016 CATTGAGAATGGAGAGATTTAGG - Intergenic
1049529492 8:143147277-143147299 GAATGTGTTTGGAGAGAAGGGGG + Intergenic
1049529497 8:143147302-143147324 GCATGAGTTTGGAGAGAAGGGGG + Intergenic
1049529501 8:143147327-143147349 GGATGAGTTTGGAGAGAAGGAGG + Intergenic
1049529513 8:143147377-143147399 GGATGAGTTTGGAGAGAAGGGGG + Intergenic
1050010069 9:1176892-1176914 CAAGGAGAGAGGGGAGAAGGGGG - Intergenic
1050013748 9:1211402-1211424 CTATGAGAATGGAGACAACAAGG - Intergenic
1050590367 9:7154137-7154159 CCATTAGACTGGGGAGAAGGGGG + Intergenic
1050684033 9:8147247-8147269 CATTGAGAATGGACAGAGGGAGG + Intergenic
1050866083 9:10501173-10501195 CAATGAGGATGTAGAGAAAAGGG - Intronic
1051145110 9:14019018-14019040 AAATGAGCCTGGAGAGAGGGAGG - Intergenic
1051565504 9:18493409-18493431 GAATGAGAATGAAGAGAGGTGGG - Intronic
1052174468 9:25441663-25441685 CATTAAGAATGGAATGAAGGGGG + Intergenic
1053139653 9:35674585-35674607 GGATGAGATGGGAGAGAAGGGGG + Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053381838 9:37655290-37655312 CAGAGAGAATGGAAAGATGGGGG - Intronic
1055438061 9:76312101-76312123 CAGGAAGAATGGAGAGAGGGAGG + Intronic
1055532147 9:77194783-77194805 CACTGAGAGTGAACAGAAGGAGG - Intronic
1056182849 9:84102389-84102411 CAGTGAGGAGGGAAAGAAGGAGG + Intergenic
1058091685 9:100813014-100813036 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1058378100 9:104348362-104348384 AAATAAGAATGTAGAGAAAGAGG - Intergenic
1058765735 9:108181149-108181171 TACAGAGAATGGAGAGGAGGGGG + Intergenic
1059081507 9:111255135-111255157 AAATGAGAACCGAGTGAAGGGGG - Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059656931 9:116365837-116365859 CACAGAGAGAGGAGAGAAGGAGG - Intronic
1059872363 9:118592331-118592353 CACTGAGAATGGGGTGATGGTGG - Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060283535 9:122229016-122229038 CAAGGAGGAGGGAGAGGAGGAGG - Intronic
1060291948 9:122311340-122311362 CAGTGAGAAGGGAGAAAGGGAGG - Intronic
1061013949 9:127971350-127971372 CAAGCAGAATGGAAAGGAGGAGG - Intronic
1061538859 9:131266531-131266553 CTATGAGAGAGGAGAGGAGGAGG - Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062050513 9:134444418-134444440 GAAGGAGAAAGGAGGGAAGGAGG - Intergenic
1062744652 9:138203585-138203607 GAATGAGGAGGGGGAGAAGGAGG + Intergenic
1185592520 X:1286964-1286986 CACAGAGAAAGGATAGAAGGAGG + Intronic
1185603547 X:1354830-1354852 GGAGGAGAATGGAGAGGAGGAGG + Intronic
1186039937 X:5464523-5464545 GAAAGGGAATGGAGAGAGGGAGG + Intergenic
1186107451 X:6222848-6222870 GAATGAGAACCGAGTGAAGGGGG - Intronic
1186108534 X:6230950-6230972 CATTGAGTATGAAAAGAAGGTGG + Intergenic
1186172412 X:6891445-6891467 CTTTGAGAATGGAAAGAAAGGGG - Intergenic
1186203399 X:7176677-7176699 GAATGAGAACCGAGTGAAGGAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186872725 X:13788381-13788403 GAAAGAGAGTGGAGAGAAGGGGG + Intronic
1187106403 X:16247362-16247384 GATTGAGAATGAGGAGAAGGAGG - Intergenic
1187289504 X:17939664-17939686 AAATCAGAATGGAGAGACAGAGG + Intergenic
1187351346 X:18520744-18520766 CAATGAGGAGGAGGAGAAGGAGG - Intronic
1187375460 X:18748965-18748987 CAAAGAGCATGGATAGAAGGTGG + Intronic
1187380415 X:18796688-18796710 CAATGAGGAGAGAGAGAAGTGGG + Intronic
1187408888 X:19029840-19029862 CAGAGAGGAGGGAGAGAAGGAGG + Intronic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187614774 X:20981245-20981267 CATTGAGACAGGACAGAAGGTGG + Intergenic
1187847093 X:23551110-23551132 AAGTGAGAATGAAGAGAAAGCGG - Intergenic
1188343434 X:29033861-29033883 CAATGAGAATGAAAAGAAAAGGG + Intronic
1188564856 X:31514916-31514938 CAATGAGAGTTGAGAGAAATAGG + Intronic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1188970788 X:36613095-36613117 CAATGAGACTGGATAGAAGAGGG + Intergenic
1189678199 X:43486286-43486308 CACTGAGAATGGATGGAGGGAGG + Intergenic
1190000847 X:46685129-46685151 CAATGAGAGTGGGGAAAAGAAGG - Intronic
1190453553 X:50603901-50603923 CAATGAGAATATAGTGAGGGCGG - Intronic
1190924118 X:54886311-54886333 CACGGAGAATGGAGAAAAGCAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191767841 X:64719817-64719839 CAGTCAGGATGGAAAGAAGGTGG - Intergenic
1191944330 X:66514996-66515018 CATTGAGAGTGGACAGAGGGAGG - Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192373750 X:70538116-70538138 TAAGAAGAAGGGAGAGAAGGAGG + Intronic
1192531539 X:71891664-71891686 CTATGAGAAGGGAGAGAAAGAGG + Intergenic
1192546032 X:72015212-72015234 CAAAAAGACTGGAGAGGAGGTGG - Intergenic
1192631496 X:72781207-72781229 CAAGGTCAATGGAGAGACGGCGG - Intronic
1192650213 X:72939594-72939616 CAAGGTCAATGGAGAGACGGCGG + Intronic
1192855807 X:75010640-75010662 TAAAGAGAATGTAGAGAAAGAGG - Intergenic
1193036707 X:76958632-76958654 CATTGAGAGTGGACAGAGGGAGG - Intergenic
1193091258 X:77495708-77495730 CAAGGAGAATGGAAACAAGCTGG + Intergenic
1193747723 X:85302446-85302468 CAACGAGGATGGGGAGAAAGTGG + Intronic
1193758942 X:85441430-85441452 CATGGAGAATGAAGAAAAGGGGG - Intergenic
1193768383 X:85560012-85560034 CAAGGAGAATGGAAACAAGCTGG - Intergenic
1193851504 X:86543126-86543148 CATTGAGAGTGGAAAGAATGAGG + Intronic
1194018435 X:88656883-88656905 CATTGAGAGTGTATAGAAGGAGG + Intergenic
1194026051 X:88752356-88752378 CATTGAGAATGAACAGAAAGTGG + Intronic
1194240645 X:91443052-91443074 CAATGAGAATGTAGAAAAGGTGG + Intergenic
1194766861 X:97851812-97851834 GAATGAGAATTGAGTGAAGGGGG + Intergenic
1195006469 X:100690419-100690441 CTAAGAGAATGGAGGGAGGGAGG + Intronic
1195496873 X:105546426-105546448 TCATTAAAATGGAGAGAAGGAGG + Intronic
1195714150 X:107802193-107802215 CGATGAGAATGTAGAGAAATTGG + Intergenic
1196153690 X:112404054-112404076 CAATCAGAAGGGAGAAATGGGGG - Intergenic
1196267711 X:113671176-113671198 AAATGAGAATGCAGAGGAGGGGG - Intergenic
1196543506 X:116936767-116936789 GAATGAGAACTGAGTGAAGGGGG + Intergenic
1196548543 X:116994859-116994881 GAATGAGAAGGGAGGGGAGGAGG + Intergenic
1197898308 X:131341201-131341223 CTAAGAGTATGGAGAGAGGGTGG + Intronic
1197916629 X:131542682-131542704 CAAAGATAAAAGAGAGAAGGAGG + Intergenic
1198409471 X:136351165-136351187 CAATGAGAGTGGAGAATTGGTGG + Intronic
1198429004 X:136547187-136547209 CCAAGATAATGGAGAGAGGGTGG - Intronic
1199778314 X:151034968-151034990 GACAGAGGATGGAGAGAAGGAGG - Intergenic
1200298869 X:154952161-154952183 CCATGAGGCTGGAGAGAAGAGGG + Intronic
1201254922 Y:12097908-12097930 CAATGAGAATGGACACAAGGAGG + Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic