ID: 1008556053

View in Genome Browser
Species Human (GRCh38)
Location 6:52673586-52673608
Sequence AAGGATGCCCAGATCAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008556053_1008556062 16 Left 1008556053 6:52673586-52673608 CCCTGTTTGATCTGGGCATCCTT 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1008556062 6:52673625-52673647 CTGGGTGCCACTCCTTGTTATGG No data
1008556053_1008556058 -2 Left 1008556053 6:52673586-52673608 CCCTGTTTGATCTGGGCATCCTT 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1008556058 6:52673607-52673629 TTAGGCTCCCAGTCCTTGCTGGG No data
1008556053_1008556057 -3 Left 1008556053 6:52673586-52673608 CCCTGTTTGATCTGGGCATCCTT 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1008556057 6:52673606-52673628 CTTAGGCTCCCAGTCCTTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008556053 Original CRISPR AAGGATGCCCAGATCAAACA GGG (reversed) Intronic
902832834 1:19028803-19028825 AATGATGCCCTGGTCACACAGGG - Intergenic
903123335 1:21231147-21231169 AAGGATCCCAAGACCAAAAAAGG + Intronic
904776357 1:32909860-32909882 AAGGATGCCAAGATGATTCAAGG + Intergenic
905023003 1:34830753-34830775 GAGCATGCCCAGATGAACCAAGG + Intronic
905616068 1:39400028-39400050 AAGGAAGCCCAGAAGAAAGATGG - Intronic
915152561 1:153846213-153846235 AAGGAAGCACAGAACAAGCAAGG - Intronic
918638168 1:186804839-186804861 GAGGAAGCACAGATCAGACATGG + Intergenic
921999808 1:221465223-221465245 AATGATGGCCAGATCCCACAGGG - Intergenic
1063228674 10:4042101-4042123 AAGGATGCCAAGGTCAAAACGGG - Intergenic
1064432742 10:15285299-15285321 AAGTAAGGCCAGATCACACATGG + Intronic
1065679193 10:28211830-28211852 ATGGGAGCCCAGATCACACAGGG + Intronic
1067435637 10:46274319-46274341 GAGGAAGCCCAGGTCACACAGGG - Intergenic
1067573466 10:47388547-47388569 GAGGAAGCCCAGGTCATACAGGG + Intergenic
1068751356 10:60596407-60596429 ATGCATGCCCTAATCAAACATGG + Intronic
1069532853 10:69231695-69231717 AGGGATGCGCAGATGAAAGACGG - Intronic
1069633102 10:69909498-69909520 AAGGGTGCCCAGACCAGCCATGG - Intronic
1071490345 10:86131960-86131982 TAGCATTCCCAGATCACACAAGG + Intronic
1074699438 10:116080166-116080188 AATGGTGCCCAGCTCAAAAATGG - Intronic
1075634001 10:124018092-124018114 AAGGAGGCCCCTATCAAAGATGG + Intronic
1078603456 11:12754375-12754397 AAGCATACCCAAATCACACATGG - Intronic
1078994001 11:16678619-16678641 AAGGATGGCAAGCTGAAACAGGG + Intronic
1080101293 11:28462782-28462804 AAGGGTTCCCAAATCAAACTTGG + Intergenic
1080190283 11:29537238-29537260 AAGGTTACACAGATAAAACATGG + Intergenic
1082960643 11:58915771-58915793 ACGGATGCCCAGTTCCAGCAGGG - Intronic
1084323104 11:68384461-68384483 AAGGATGCACAGAGCCAAGAAGG - Intronic
1086487097 11:87317814-87317836 AAGGATGAACAGATCTATCAGGG + Intronic
1092650790 12:10632491-10632513 AGGGAGGCCCAGATCACATAAGG + Intronic
1093876505 12:24354882-24354904 AAGGATGCTTAAATCAAACTGGG + Intergenic
1094223136 12:28016138-28016160 ACGGATGCCCAGAGAAAACTGGG + Intergenic
1097162199 12:57055075-57055097 AAGGATTCCCAGAGCAAAGAAGG + Intergenic
1098006119 12:65998740-65998762 AAGGAGGCCATGATGAAACAGGG - Intergenic
1103578130 12:121894016-121894038 AAGGATGCCCAGCTTGTACATGG + Intronic
1106612817 13:31299843-31299865 AAGGATGCCCATATGAAGCATGG - Intronic
1106785067 13:33099331-33099353 TGGGGTGCCCAGATTAAACATGG - Intergenic
1109373265 13:61453142-61453164 AAGGATGCCAAGAATACACAAGG - Intergenic
1111175101 13:84584439-84584461 AAAGATACCCAAATGAAACAAGG + Intergenic
1111538850 13:89643498-89643520 AAAGGTGCCCAGAACACACATGG - Intergenic
1117514796 14:56490046-56490068 GATGATGGCCAGATCATACACGG - Intronic
1118888665 14:69888415-69888437 AAGGATGCTGAAATCAACCAAGG - Intronic
1119108141 14:71943742-71943764 AAGGATGCAGAGAAAAAACATGG - Intronic
1119583224 14:75806585-75806607 ACAGATGCCCAGATTAGACATGG - Intronic
1121029450 14:90645688-90645710 AGGGATGACCAGAGCAACCAGGG + Intronic
1121032140 14:90667275-90667297 AAGGAGGGCCACAGCAAACATGG + Intronic
1121528913 14:94638985-94639007 AAGGATGCCCTGGTCCAACCTGG - Intergenic
1122344019 14:101046906-101046928 TAGGAAGCCCAGAGCATACACGG + Intergenic
1122605443 14:102944826-102944848 AAGGAGGCCCAGATCACCCCAGG - Intronic
1122783223 14:104152499-104152521 AAGGAAGCCCAGTTCTGACAAGG - Intronic
1125539057 15:40459291-40459313 AAGGCTGCCCTGATGAACCATGG + Exonic
1127057886 15:55151041-55151063 AAGGATGCCCAAATCCTGCATGG + Intergenic
1132721671 16:1319603-1319625 GAGGATGCCCAGGTAAAAGATGG + Intronic
1134291361 16:12904440-12904462 CAGAACGCCCAGATCAAAGAGGG - Intronic
1134601343 16:15536176-15536198 AAGGCTGTCCAGATGAGACAAGG + Intronic
1135034849 16:19068332-19068354 AAGGCAGCACAGATGAAACAAGG - Intronic
1137042150 16:35623014-35623036 AAGGTTTCCCAGACTAAACAGGG - Intergenic
1137568330 16:49548179-49548201 AAGAATGCTCAGACCAAACTGGG - Intronic
1141416306 16:83878030-83878052 AAACTTGCCCAGATCATACAGGG - Intergenic
1144482383 17:15638729-15638751 AATGAGACCCAGATCAAAAAGGG + Intronic
1144916300 17:18726303-18726325 AATGAGACCCAGATCAAAAAGGG - Intronic
1146662147 17:34672045-34672067 AAGCATGGCCAGATCACACAAGG + Intergenic
1148189580 17:45669192-45669214 AATGATGCCCAGATGTTACAGGG - Intergenic
1151342002 17:73477552-73477574 CTGGATGCCCACATCAAAGATGG - Intronic
1151406046 17:73887075-73887097 AAAGATGCTCTTATCAAACAGGG - Intergenic
1151551331 17:74824149-74824171 GAGGCTGCCCAGAGCAAACCTGG - Intronic
1152143853 17:78555687-78555709 CAGGGTGCCCAGATTAAACATGG + Intronic
1152333294 17:79685832-79685854 ATGGATGACCAGATCATTCACGG - Intergenic
1153732652 18:8029866-8029888 ACGGATGGTCAGATCACACAGGG - Intronic
1155425228 18:25700066-25700088 AAGCAGGCCAAGAGCAAACAGGG - Intergenic
1155763765 18:29601847-29601869 AAAGATGCCAAGAACATACATGG + Intergenic
1163543480 19:17926235-17926257 CAGAATGACCACATCAAACAGGG - Intergenic
1165362328 19:35344653-35344675 AGGGAGGCCCAGAGCAAGCAGGG + Intronic
1167111934 19:47467675-47467697 AAGGAAACCCAGATAAGACACGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
925942258 2:8831816-8831838 AAGAATGCCAACATCAAACAAGG + Intronic
926884646 2:17585780-17585802 AAGAATTCCAAGATCACACAAGG - Intronic
929341861 2:40829347-40829369 AAGGATGCCTATATCAAAGCAGG + Intergenic
929384748 2:41392870-41392892 AAGGGTGCCAAGATCATTCAAGG - Intergenic
931208346 2:60169076-60169098 AAGGAGGCCCAGAATAGACAAGG + Intergenic
931921302 2:67018828-67018850 AAGGATGGCAACATCAAAGATGG + Intergenic
934767946 2:96890916-96890938 AATAAAGCCCAGATCAAACCAGG + Intronic
935496185 2:103784203-103784225 AAGGATGCCCATAGAAAACAGGG - Intergenic
936934860 2:117829452-117829474 AAGGATACTCAGATCAACGAAGG - Exonic
938282621 2:130075184-130075206 AAGGAGGCCCAGAGCAAAAGAGG - Exonic
939042503 2:137207965-137207987 AAGTGTTCCCAGACCAAACAGGG + Intronic
940750558 2:157622727-157622749 ACAGATGCCCAAAGCAAACATGG + Intronic
941354937 2:164478986-164479008 ATAGATGTCCAGATCAAATAGGG - Intergenic
944751191 2:202711810-202711832 AAAGATGCCAAGAACATACATGG - Intronic
945223308 2:207506359-207506381 AAGTGTGGCAAGATCAAACAGGG - Intergenic
948188621 2:236041669-236041691 AAGGAAGTTCAGTTCAAACAAGG + Intronic
1168990519 20:2091587-2091609 CAGGATCCCCAACTCAAACACGG + Intergenic
1174497120 20:50955231-50955253 ATGGAAGCCCAGATGGAACAAGG - Exonic
1178533534 21:33394261-33394283 GAGGATGCCCAGCTCAGAGATGG - Intergenic
1179566147 21:42250408-42250430 CAGGATGCCCAGAGCACCCACGG - Intronic
1181803545 22:25361962-25361984 AAGGATGCACAGAGCCAAGAAGG + Exonic
1183938810 22:41280716-41280738 AGGGATGCCCAATACAAACATGG + Intronic
1184348149 22:43925487-43925509 AAGGAAGCCCAGATAAAAGGGGG - Intronic
951039726 3:17976311-17976333 AAGGATGTCTAAAACAAACATGG + Intronic
953220264 3:40963988-40964010 AAAGATGCCAAGAACATACATGG - Intergenic
954145617 3:48632923-48632945 GAGGATGCCCACATCCATCATGG - Intronic
954665597 3:52249851-52249873 AGGGATGCCCAGACCACACCCGG - Exonic
956251949 3:67243755-67243777 AAGGATTCCATCATCAAACAAGG + Intergenic
958038048 3:88192845-88192867 CAGGGTGCCCAGATTAAACATGG - Intergenic
958263126 3:91405643-91405665 AAGAATGCACAGAGCAAAGATGG + Intergenic
958690203 3:97455878-97455900 AATTATGCCTAGATCAAATAAGG + Intronic
960211417 3:114971568-114971590 AAGGATGAACAGAATAAACAAGG + Intronic
962272191 3:133985715-133985737 AATGATGCCCAGTTCAAAATTGG + Intronic
965206256 3:165721259-165721281 AAGGATGTCCAGGTCCACCAGGG + Intergenic
969609873 4:8221010-8221032 AGGGATTCCCAGCACAAACAAGG + Intronic
969658049 4:8509371-8509393 AAGGCTGCCCACTTCACACAGGG - Intergenic
976248784 4:83029681-83029703 AAGGAGGCCCTGATCAGATATGG + Intergenic
981649281 4:147037726-147037748 ATGGATGTGCAGATGAAACAGGG + Intergenic
984497755 4:180519454-180519476 AAGGTTCCCAAGACCAAACATGG - Intergenic
987401662 5:17484274-17484296 AAAGAAGCCCATATCAAACATGG + Intergenic
992294396 5:75313005-75313027 AAGGATTGCCAGATAAAAGAGGG - Intergenic
994625214 5:102209813-102209835 AAGGATGCCAAGAACACACAAGG + Intergenic
995556947 5:113339385-113339407 AAGGAAGCCTAGATAAAATATGG - Intronic
996253451 5:121368222-121368244 AAGACTGCCCAGTCCAAACATGG - Intergenic
997026704 5:130072426-130072448 AAGGATGCCAAGAACACACATGG - Intronic
1002971626 6:2028622-2028644 AAGGATGCCCACTTTAAATAAGG + Intronic
1004525568 6:16404329-16404351 AAACATGCTCAGTTCAAACAAGG - Intronic
1008556053 6:52673586-52673608 AAGGATGCCCAGATCAAACAGGG - Intronic
1008566027 6:52769154-52769176 AAGCTTGCCCTGATCAAAGAGGG - Intergenic
1008992282 6:57617245-57617267 AAGAATGCACAGAGCAAAGATGG - Intronic
1009180905 6:60516357-60516379 AAGAATGCACAGAGCAAAGATGG - Intergenic
1012307545 6:97677182-97677204 AAGGAAGCCCAGAGGAAAGAGGG - Intergenic
1012536700 6:100307110-100307132 AAGGAAGCCTAGGTCAAACCTGG - Intergenic
1015855168 6:137616548-137616570 AAGGAAGCCCAGATGAAAGCTGG - Intergenic
1018331589 6:162733638-162733660 AAGGGTGGGCAGATCACACAGGG - Intronic
1019568551 7:1697085-1697107 CGCGAAGCCCAGATCAAACAGGG - Intronic
1019957231 7:4424995-4425017 GAGCATGCCCAGATGAACCAAGG - Intergenic
1025530720 7:61879153-61879175 ATGAATGCCCACATCAAAAAGGG + Intergenic
1030378421 7:108781793-108781815 AAGGTTGCCTAGATAAAACAGGG - Intergenic
1030766261 7:113413472-113413494 CAGAATACCCAGATTAAACATGG - Intergenic
1032599315 7:133276275-133276297 AAGGATGAACTGATCAAATAAGG + Intronic
1032831911 7:135636197-135636219 AAAGATGCTCAGACCAAACCAGG - Intronic
1034543483 7:151775104-151775126 AAGGATGCCCTCATCACACGTGG - Intronic
1038366956 8:26946255-26946277 ATGGATGCCAAAATCAAGCAGGG - Intergenic
1038623858 8:29171513-29171535 AAGTATGCCCATGTCAAACTAGG + Intronic
1040135950 8:43853959-43853981 AAATATACCCAGATAAAACATGG + Intergenic
1041127557 8:54659497-54659519 AAGGGTGCCAAGACCACACAAGG - Intergenic
1041862061 8:62525667-62525689 GAGTATGCCCAGATTAACCAAGG - Intronic
1044844433 8:96366421-96366443 GAGCATGCCCAGATGAACCAAGG + Intergenic
1050507697 9:6364619-6364641 AGGGATGCCCAGAGAGAACACGG - Intergenic
1050598945 9:7231431-7231453 AAGAATGCCCAGATAAATAAGGG + Intergenic
1051944969 9:22557290-22557312 TACGATGCCCAGATCCATCATGG + Intergenic
1053275778 9:36782275-36782297 AGAGATGCCCAGATCAAAGAGGG - Intergenic
1054988910 9:71298219-71298241 AAAGATTTCCAGATCAAACAAGG - Intronic
1055785497 9:79865316-79865338 AAGGAGGCTCAGATGAGACAAGG - Intergenic
1057064005 9:92031827-92031849 AAGGATGCTCAGATTAGAAATGG + Intergenic
1059455046 9:114395065-114395087 AAGGAAGCCCAGAGCCAAGATGG + Intergenic
1203613719 Un_KI270749v1:32816-32838 AAGGATGCCAAGAAAAAAAATGG - Intergenic
1186794836 X:13035599-13035621 AAGAATGCACAGATAAAATAAGG + Intronic
1186952719 X:14645170-14645192 AACCATGCACAGAGCAAACATGG - Intronic
1187954582 X:24504523-24504545 AAGGATGCCTAAATAAAATAGGG - Intronic
1188807261 X:34606968-34606990 AAGCATTCCCAGGTCAGACACGG + Intergenic
1190870042 X:54417038-54417060 AAGGATTCCCAGATCATACTTGG - Intergenic
1190961024 X:55247756-55247778 AAGGATGCCCACTTTCAACAAGG + Intronic
1197426866 X:126307685-126307707 AAGGAGGCCCTCAGCAAACATGG - Intergenic
1198360509 X:135890517-135890539 AAGCATGGCCAGATCACCCACGG + Intronic
1198747004 X:139901185-139901207 AAGAATGCCCAAATGAAGCATGG + Intronic
1201368262 Y:13233086-13233108 AAGAATGCCCAGGGCAAATAGGG - Intergenic