ID: 1008559423

View in Genome Browser
Species Human (GRCh38)
Location 6:52709282-52709304
Sequence CGATGGGCAATGTAAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008559419_1008559423 18 Left 1008559419 6:52709241-52709263 CCAACCAGTGATCTCTAACTGCT 0: 3
1: 26
2: 56
3: 82
4: 232
Right 1008559423 6:52709282-52709304 CGATGGGCAATGTAAAAATCTGG No data
1008559420_1008559423 14 Left 1008559420 6:52709245-52709267 CCAGTGATCTCTAACTGCTGCTC 0: 5
1: 23
2: 66
3: 80
4: 249
Right 1008559423 6:52709282-52709304 CGATGGGCAATGTAAAAATCTGG No data
1008559418_1008559423 26 Left 1008559418 6:52709233-52709255 CCTGTGAACCAACCAGTGATCTC 0: 61
1: 91
2: 136
3: 118
4: 190
Right 1008559423 6:52709282-52709304 CGATGGGCAATGTAAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008559423 Original CRISPR CGATGGGCAATGTAAAAATC TGG Intergenic
No off target data available for this crispr