ID: 1008567220

View in Genome Browser
Species Human (GRCh38)
Location 6:52781201-52781223
Sequence AACCTTGAATGGCTTCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008567217_1008567220 -3 Left 1008567217 6:52781181-52781203 CCATAGCATTGCAGACCTTTAAC No data
Right 1008567220 6:52781201-52781223 AACCTTGAATGGCTTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008567220 Original CRISPR AACCTTGAATGGCTTCTGTC TGG Intergenic
No off target data available for this crispr