ID: 1008570248

View in Genome Browser
Species Human (GRCh38)
Location 6:52809919-52809941
Sequence TAACCACTGATGCTACAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008570246_1008570248 20 Left 1008570246 6:52809876-52809898 CCAGCGTCACAGTCATGAGAGAA No data
Right 1008570248 6:52809919-52809941 TAACCACTGATGCTACAAATAGG No data
1008570245_1008570248 25 Left 1008570245 6:52809871-52809893 CCTGTCCAGCGTCACAGTCATGA No data
Right 1008570248 6:52809919-52809941 TAACCACTGATGCTACAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008570248 Original CRISPR TAACCACTGATGCTACAAAT AGG Intergenic
No off target data available for this crispr