ID: 1008570662

View in Genome Browser
Species Human (GRCh38)
Location 6:52813521-52813543
Sequence AACCTTGAATGGCTTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008570658_1008570662 -3 Left 1008570658 6:52813501-52813523 CCATAGCACTGTAGACCTTTAAC No data
Right 1008570662 6:52813521-52813543 AACCTTGAATGGCTTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008570662 Original CRISPR AACCTTGAATGGCTTCTGGC TGG Intergenic
No off target data available for this crispr