ID: 1008570690 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:52813844-52813866 |
Sequence | CCTATGGCATACCCATGCTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1008570690_1008570698 | 8 | Left | 1008570690 | 6:52813844-52813866 | CCCCAGCATGGGTATGCCATAGG | No data | ||
Right | 1008570698 | 6:52813875-52813897 | CACCAAAGATTCTGCCACCAAGG | 0: 2 1: 0 2: 3 3: 15 4: 249 |
||||
1008570690_1008570699 | 9 | Left | 1008570690 | 6:52813844-52813866 | CCCCAGCATGGGTATGCCATAGG | No data | ||
Right | 1008570699 | 6:52813876-52813898 | ACCAAAGATTCTGCCACCAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1008570690 | Original CRISPR | CCTATGGCATACCCATGCTG GGG (reversed) | Intergenic | ||