ID: 1008570690

View in Genome Browser
Species Human (GRCh38)
Location 6:52813844-52813866
Sequence CCTATGGCATACCCATGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008570690_1008570698 8 Left 1008570690 6:52813844-52813866 CCCCAGCATGGGTATGCCATAGG No data
Right 1008570698 6:52813875-52813897 CACCAAAGATTCTGCCACCAAGG No data
1008570690_1008570699 9 Left 1008570690 6:52813844-52813866 CCCCAGCATGGGTATGCCATAGG No data
Right 1008570699 6:52813876-52813898 ACCAAAGATTCTGCCACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008570690 Original CRISPR CCTATGGCATACCCATGCTG GGG (reversed) Intergenic