ID: 1008570698

View in Genome Browser
Species Human (GRCh38)
Location 6:52813875-52813897
Sequence CACCAAAGATTCTGCCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008570690_1008570698 8 Left 1008570690 6:52813844-52813866 CCCCAGCATGGGTATGCCATAGG No data
Right 1008570698 6:52813875-52813897 CACCAAAGATTCTGCCACCAAGG No data
1008570692_1008570698 7 Left 1008570692 6:52813845-52813867 CCCAGCATGGGTATGCCATAGGC No data
Right 1008570698 6:52813875-52813897 CACCAAAGATTCTGCCACCAAGG No data
1008570695_1008570698 -8 Left 1008570695 6:52813860-52813882 CCATAGGCCAGTGGCCACCAAAG No data
Right 1008570698 6:52813875-52813897 CACCAAAGATTCTGCCACCAAGG No data
1008570693_1008570698 6 Left 1008570693 6:52813846-52813868 CCAGCATGGGTATGCCATAGGCC No data
Right 1008570698 6:52813875-52813897 CACCAAAGATTCTGCCACCAAGG No data
1008570689_1008570698 17 Left 1008570689 6:52813835-52813857 CCTTTGTGACCCCAGCATGGGTA No data
Right 1008570698 6:52813875-52813897 CACCAAAGATTCTGCCACCAAGG No data
1008570686_1008570698 23 Left 1008570686 6:52813829-52813851 CCACAACCTTTGTGACCCCAGCA No data
Right 1008570698 6:52813875-52813897 CACCAAAGATTCTGCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008570698 Original CRISPR CACCAAAGATTCTGCCACCA AGG Intergenic