ID: 1008572822

View in Genome Browser
Species Human (GRCh38)
Location 6:52831269-52831291
Sequence CAGGGTGGCCTGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008572813_1008572822 30 Left 1008572813 6:52831216-52831238 CCTTAAGGAGCAGAGTGAGGATG 0: 3
1: 1
2: 1
3: 24
4: 231
Right 1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG No data
1008572815_1008572822 5 Left 1008572815 6:52831241-52831263 CCAGGAGCACACGCACTGTAAGG No data
Right 1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008572822 Original CRISPR CAGGGTGGCCTGAGAGCAGA GGG Intergenic
No off target data available for this crispr