ID: 1008578586

View in Genome Browser
Species Human (GRCh38)
Location 6:52884649-52884671
Sequence TATTACAAGAAGAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008578586 Original CRISPR TATTACAAGAAGAAAGTGGG TGG (reversed) Intronic
902096735 1:13951812-13951834 TTATAAAAGCAGAAAGTGGGTGG - Intergenic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
902630912 1:17704038-17704060 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
903734617 1:25522322-25522344 TTCTCCAAGGAGAAAGTGGGTGG - Intergenic
904692687 1:32306122-32306144 TTTCAGAAGAACAAAGTGGGAGG - Intronic
906398681 1:45489206-45489228 GATTTCAAGAAGGGAGTGGGGGG - Intronic
906909589 1:49933629-49933651 TATGACAATAACAAAGTGTGAGG + Intronic
907941991 1:59096806-59096828 TTTTACAAATAAAAAGTGGGGGG - Intergenic
908055758 1:60285024-60285046 TATTAGAAAAAGAAAGTATGGGG + Intergenic
909746311 1:79101933-79101955 CAATACAAGATGAAATTGGGTGG - Intergenic
911051187 1:93672830-93672852 TAGTACAAGAAGAAAATAAGTGG - Intronic
911280361 1:95919406-95919428 TTTTAAAAGAACAAAGTTGGAGG + Intergenic
912528396 1:110302410-110302432 TATTCCAAGAAGAAAGGTGTGGG - Intergenic
912830724 1:112951223-112951245 TATTACAAATGAAAAGTGGGGGG + Intronic
915311295 1:155007125-155007147 GATAGCAAGAATAAAGTGGGGGG - Intronic
915643719 1:157251695-157251717 TATCAGAAGAAGATAGAGGGAGG - Intergenic
917223623 1:172758504-172758526 AATTACAGAAAGAAAGTGGGAGG - Intergenic
918132984 1:181645424-181645446 TATAAGAAGAAAAAAGAGGGTGG - Intronic
920064022 1:203252522-203252544 TATCAAAAGAAAAAAGGGGGGGG - Intronic
921223707 1:212995801-212995823 TATTCCCAGAAGAAAGGAGGGGG + Intronic
921261460 1:213388469-213388491 AATTGCATGAAGAATGTGGGAGG - Intergenic
921401820 1:214732400-214732422 TCTTATAAGAAAAAAGTGGGAGG - Intergenic
921460602 1:215421685-215421707 TATTACAGTTAGAAAGTTGGGGG - Intergenic
921983334 1:221282678-221282700 AAATAAAAGAAGAGAGTGGGAGG - Intergenic
923351740 1:233114193-233114215 AATTACAATATGAAACTGGGTGG + Intronic
923557274 1:235010965-235010987 TTTTACAAGATGAAAGTGCCTGG - Intergenic
923675196 1:236074821-236074843 TATTACAAGAAGGTATTAGGAGG + Intergenic
924169975 1:241328725-241328747 TGTTACAAGAAGACAGTGTAAGG - Intronic
924370657 1:243346654-243346676 GAAGAAAAGAAGAAAGTGGGTGG - Intronic
1062927142 10:1325701-1325723 TAGTACAAGAAAGATGTGGGAGG - Intronic
1063708776 10:8457004-8457026 TGTTCCAAGCAGAAAGTGTGTGG - Intergenic
1063915821 10:10880990-10881012 TGTGACATGAAGAAGGTGGGTGG - Intergenic
1065048221 10:21763378-21763400 TATTAACATAAGAAAGAGGGAGG + Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1066205539 10:33185898-33185920 TATTATAAGAAGAGAGTGTAAGG - Intronic
1069279095 10:66631013-66631035 TACTACAAGAAGATAGAGGTAGG + Intronic
1069499074 10:68933635-68933657 TATTAAAAAAAAAAAGTGGCCGG + Intronic
1070843406 10:79503567-79503589 AATTACAGGAAGATGGTGGGGGG + Intergenic
1070930259 10:80256034-80256056 AATTACAGGAAGATGGTGGGGGG - Intergenic
1071945977 10:90645368-90645390 TATTACAATAAAAAATTAGGGGG - Intergenic
1072696378 10:97606682-97606704 TAAAAAAAGAACAAAGTGGGAGG - Intronic
1074304814 10:112267480-112267502 CATTACTAGAAGAAAGTTTGGGG - Intergenic
1074486154 10:113883102-113883124 TTGAAAAAGAAGAAAGTGGGAGG - Intronic
1074964418 10:118477235-118477257 TAATAAAAGAAGTAAGTAGGAGG - Intergenic
1076556878 10:131330062-131330084 TTTAAAGAGAAGAAAGTGGGAGG - Intergenic
1077946192 11:6902440-6902462 TCTTAGAAGAAAAAAATGGGTGG + Intergenic
1078253013 11:9633496-9633518 TATTTCAGGAAGAAACTGGGTGG + Intergenic
1078986119 11:16600581-16600603 TATCAGTTGAAGAAAGTGGGTGG - Intronic
1080049262 11:27842243-27842265 TATTACTAGGAGAAAGGGGTAGG + Intergenic
1082114905 11:48316916-48316938 TAAAACTAGAAGAAAATGGGAGG + Intergenic
1082971830 11:59030871-59030893 AGTTTAAAGAAGAAAGTGGGGGG + Intronic
1083379055 11:62249577-62249599 TCTTCCAAAAAAAAAGTGGGGGG - Intergenic
1083584322 11:63845686-63845708 TATAACAAAAAGGAAGGGGGCGG - Intronic
1085500454 11:77017769-77017791 TTTTACAAGTAGAAAGTTTGTGG + Intronic
1085871666 11:80357533-80357555 TGGTACAAGAAGAAAGTAAGCGG - Intergenic
1086062546 11:82714768-82714790 TAACAGAAGAGGAAAGTGGGAGG + Intergenic
1086808476 11:91273507-91273529 TGTTACATGGAGAAAGAGGGAGG - Intergenic
1087190490 11:95249276-95249298 TATCTTAAGAAGAAAATGGGAGG + Intergenic
1087939316 11:104076044-104076066 TATTATAAGAATAACATGGGAGG - Intronic
1088082352 11:105933893-105933915 TGTGACACGATGAAAGTGGGAGG + Exonic
1088174769 11:107039984-107040006 TATTACAGGGTGAGAGTGGGAGG + Intergenic
1088963599 11:114695694-114695716 TATAAAAAGAAGAAATTGGCCGG + Intronic
1089034590 11:115373657-115373679 GATTCTAAGAAGAAAATGGGAGG + Intronic
1090422694 11:126586479-126586501 AATGACAAGCAGAAAGAGGGCGG - Intronic
1090623317 11:128581869-128581891 TATTACAAGAACAATGAGAGGGG + Intronic
1091809430 12:3383156-3383178 AAATAGAAGAATAAAGTGGGAGG - Intronic
1092036186 12:5337044-5337066 TATTGCAAGAAAGAAGTGAGTGG - Intergenic
1092037846 12:5355341-5355363 TTTTAAAAGAATAAAGTTGGTGG + Intergenic
1092646357 12:10577923-10577945 TATTAATAGGAGAAACTGGGAGG + Intergenic
1092680439 12:10973961-10973983 TTTAAAAAGAACAAAGTGGGGGG + Intronic
1093236928 12:16620897-16620919 AATTAAAAGAAGAAAAAGGGAGG + Intergenic
1093850897 12:24036752-24036774 TATTTCAGGAAGGCAGTGGGAGG + Intergenic
1094175201 12:27534135-27534157 TATTAAAAGAAGAAAAAGGGAGG + Intronic
1094241546 12:28231662-28231684 TATTAATAGAAGAAAGGAGGGGG - Intronic
1095389772 12:41692075-41692097 TATCACAAGAACACTGTGGGGGG - Intergenic
1095409947 12:41910715-41910737 TAGCACAAAAAGAAAGTGGGTGG - Intergenic
1095565357 12:43616841-43616863 TTTTTTAAGAAGAAAGTTGGAGG - Intergenic
1095574173 12:43715736-43715758 TATAACAAGACGAAAGGAGGAGG - Intergenic
1096092835 12:48914799-48914821 AAAAAAAAGAAGAAAGTGGGTGG - Intronic
1098111702 12:67128690-67128712 TATAAAAAGAAGAAAAAGGGTGG + Intergenic
1098518296 12:71403722-71403744 TAATACATGAAGAAAATGAGAGG + Intronic
1099778751 12:87166944-87166966 TATTTAAAAAAAAAAGTGGGGGG + Intergenic
1099879883 12:88455220-88455242 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
1100286866 12:93174952-93174974 TATTTCCAGGAGAAGGTGGGTGG - Intergenic
1100764185 12:97845602-97845624 TAATACAAAATGAAAGTGTGAGG + Intergenic
1101599056 12:106192745-106192767 TATTGCCAGAAGAAAGGGAGTGG - Intergenic
1101998775 12:109543830-109543852 TAATAAAAAAAAAAAGTGGGGGG + Intergenic
1102542899 12:113635139-113635161 TCTTCCAAGCAGAGAGTGGGGGG - Intergenic
1102901664 12:116643274-116643296 TATTTCAAGCTGAAAGGGGGAGG - Intergenic
1103039172 12:117680744-117680766 TATTATAAAGTGAAAGTGGGAGG + Intronic
1103569212 12:121833237-121833259 TATCACTAGAAGAACGTAGGTGG + Intergenic
1105628249 13:22135015-22135037 TATTAAAAAAAGAAAGGTGGAGG - Intergenic
1106263739 13:28091519-28091541 TACCACAGGAAGAAAATGGGGGG - Intronic
1106663522 13:31827151-31827173 TATTACAGAAAGAAGCTGGGTGG + Intergenic
1106985342 13:35340943-35340965 TATTAAAAGAATAAATTTGGAGG + Intronic
1107001979 13:35558456-35558478 CATTCCAAGAAGAAAATGTGAGG + Intronic
1107224216 13:38027382-38027404 TACTACAAGAAAACATTGGGAGG - Intergenic
1108520795 13:51245284-51245306 TAATAAAAGATTAAAGTGGGGGG - Intronic
1108822026 13:54363525-54363547 TATTACTAGCAAAAAGAGGGAGG + Intergenic
1109167057 13:59048648-59048670 AATTACAAGACAAAATTGGGAGG + Intergenic
1110113314 13:71779512-71779534 TTTTACAAGCAAAAAGTTGGAGG - Intronic
1110464083 13:75780906-75780928 TATTTCATGAATAAAGTTGGAGG - Intronic
1110855940 13:80296809-80296831 AATAACAAGAAGGAAGGGGGCGG + Intergenic
1111028492 13:82566849-82566871 TAGTACAAGATGATAATGGGAGG - Intergenic
1112124308 13:96447659-96447681 TATTACAAGAGTAGGGTGGGAGG + Intronic
1113222427 13:108120419-108120441 AAATGCAAGAAGAAAGTGGCAGG - Intergenic
1114964828 14:27944101-27944123 GAGTACAAAAAGAAAGTGTGAGG - Intergenic
1116501668 14:45631590-45631612 TGTTAAGAGAAGAAACTGGGAGG + Intergenic
1116626666 14:47273495-47273517 TATAACAAGAAGAAAGTAAAAGG + Intronic
1118654111 14:67928530-67928552 TATTAAAGGACGAAGGTGGGAGG - Intronic
1118837657 14:69487991-69488013 TGTTGCAGGAAGGAAGTGGGTGG - Intronic
1120540055 14:85740368-85740390 GATAAGAAGAATAAAGTGGGAGG + Intergenic
1122582697 14:102781182-102781204 TCTTACCAAAACAAAGTGGGAGG - Intronic
1125586730 15:40825920-40825942 TTTTGCAAGATGAAAGTGGAGGG - Intronic
1127183370 15:56450072-56450094 GATTACAAAAAGAAGGTAGGAGG - Intronic
1127521487 15:59747094-59747116 TCTCAGAAGAAGAAAGTGGGAGG - Intergenic
1130425472 15:83793783-83793805 TTTTAAAAGAATAGAGTGGGAGG + Intronic
1131848989 15:96517598-96517620 TATCACAAGAACAACATGGGGGG + Intergenic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1133634456 16:7652402-7652424 AATAAGAAGAAGAATGTGGGCGG - Intronic
1134772957 16:16826510-16826532 AATTAAAAGGAGAAAGAGGGTGG - Intergenic
1135175508 16:20224524-20224546 TATAAGAAGAAGAAAGTGGACGG + Intergenic
1135379959 16:21987598-21987620 TATTTCAAGAAGAGAGTGGGTGG + Intronic
1135914711 16:26595522-26595544 TCTCAAAAAAAGAAAGTGGGGGG - Intergenic
1137862892 16:51864684-51864706 AATAACAAGAAGGAAGTGTGAGG + Intergenic
1138142891 16:54583648-54583670 TATTAAGAAAAGAAAGTGGTGGG + Intergenic
1140578761 16:76203536-76203558 TATCATAAGAAGAATGTAGGAGG - Intergenic
1141742047 16:85899975-85899997 GTTTAAAAAAAGAAAGTGGGGGG - Intronic
1142250117 16:88987769-88987791 TAATACATGAAGAAAGAGGCAGG + Intergenic
1143169128 17:4916738-4916760 AATTAAAATAAGAAACTGGGGGG - Intergenic
1143299022 17:5895420-5895442 TATTAAAAGGCTAAAGTGGGAGG + Intronic
1143528027 17:7483581-7483603 TATTTCAGGAATAAAATGGGGGG - Intronic
1144524957 17:15981452-15981474 TGTAATAAGAAGGAAGTGGGGGG + Intronic
1145221175 17:21090271-21090293 TTTTACATAAGGAAAGTGGGTGG + Intergenic
1151039672 17:70844056-70844078 TATGACAATCAGAAAGTGGAAGG - Intergenic
1152875897 17:82786008-82786030 TATTCCAAGAAGCAGGTGTGCGG - Intronic
1154078314 18:11227262-11227284 TATTACAAGAAAAAACTGGGAGG + Intergenic
1154339176 18:13488994-13489016 TCTTGCAAAAAGAAAGTGTGGGG + Intronic
1155594478 18:27469145-27469167 TATGATAAGAACAAAGTTGGAGG - Intergenic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1156553779 18:38044933-38044955 GATTACAGAAAGAAAGAGGGAGG + Intergenic
1157472057 18:47997153-47997175 TAATAGAAGAAGAAAGGAGGAGG - Intergenic
1157539135 18:48486894-48486916 TATTATGAGGAGTAAGTGGGAGG + Intergenic
1158051973 18:53233275-53233297 AATTACATGAAGAAATAGGGAGG - Intronic
1159532549 18:69672693-69672715 TATTAAAAAAAAAAAGGGGGGGG + Intronic
1159700272 18:71617661-71617683 AGTTAGAAGAAGAAAATGGGAGG + Intergenic
1159829845 18:73262943-73262965 TATTAAAAGAAGGAATTTGGAGG - Intronic
1161769130 19:6221979-6222001 GGTTACAAGAAGCCAGTGGGAGG + Intronic
1165792799 19:38502173-38502195 TATTACAGGAAGAAAGATGAGGG + Intronic
926142942 2:10379256-10379278 ATTTACAAGCAGAAAGAGGGAGG - Intronic
926834477 2:17002708-17002730 TAAGAGAAGAAGAAAGTGGTAGG + Intergenic
927257316 2:21050792-21050814 TCTCCAAAGAAGAAAGTGGGTGG + Intergenic
929078481 2:38098072-38098094 TATTTGAAGAAGAATGTGTGTGG + Intronic
929546762 2:42861003-42861025 TATGGCAGGAAGAAAGTGAGAGG + Intergenic
931947699 2:67329445-67329467 GTTTACAAGAAGAAATTGAGGGG + Intergenic
932156943 2:69426580-69426602 TATTATAAGAAAAGAGTTGGCGG - Intronic
932175888 2:69601513-69601535 TATGACCAGAATAAACTGGGTGG + Intronic
932980276 2:76655481-76655503 TATGAGAAGAACAAAGTTGGAGG - Intergenic
933406321 2:81864647-81864669 TGTTACTAGAATAAAGTGGAAGG + Intergenic
934113452 2:88764023-88764045 TATTAAAAGAACAAAGCTGGAGG - Intergenic
934941449 2:98505761-98505783 TATTTCAACAGGAAAGTGGAAGG - Intronic
935136708 2:100310612-100310634 TATAACAAGAAAAAAGTAGAAGG + Intronic
935509455 2:103953048-103953070 TATTTCATAAAGAAAGTGGTAGG - Intergenic
935867184 2:107402480-107402502 TACTATAAAAGGAAAGTGGGTGG + Intergenic
936677494 2:114732021-114732043 GAATACAAGAAGAAACTGGGAGG + Intronic
937839213 2:126508790-126508812 ACTTACAAGTAGAAAGTGGCAGG + Intergenic
939065963 2:137483707-137483729 TCTAACAAGTAGAAAATGGGAGG + Intronic
939598687 2:144161347-144161369 TCTTACAAGATGTAAGTGGGTGG - Intronic
941176435 2:162202906-162202928 AATTACAAGTGGCAAGTGGGAGG - Exonic
941519741 2:166525768-166525790 TACTAGAAGAGGAGAGTGGGAGG + Intergenic
941624076 2:167810896-167810918 TAATAGAAGAAGAAAGCAGGAGG + Intergenic
942004478 2:171684385-171684407 TAAAACAACAAAAAAGTGGGGGG + Intergenic
942439009 2:176012590-176012612 TTTAACAAGAACAAAGTTGGAGG - Intergenic
942969280 2:181938370-181938392 TAATTCAAGAAGTAAGAGGGTGG - Intergenic
943013831 2:182486498-182486520 TTTTAAAAGAACAAAGTTGGAGG + Intronic
943398815 2:187377973-187377995 TAGTAGAAGAAGGAAGTTGGAGG + Intronic
944427106 2:199594855-199594877 GGTCACAAGAAGCAAGTGGGTGG + Intergenic
945014373 2:205499591-205499613 GATTATAAGAAAAAAGTGGTGGG + Intronic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946765187 2:223033914-223033936 GACTACAAGAAGAGAGAGGGAGG - Intergenic
948267529 2:236646494-236646516 TATTAGAAGGCTAAAGTGGGTGG + Intergenic
1169259352 20:4124513-4124535 TATTATAAGAAAAAAGAGAGGGG - Intronic
1169771991 20:9211073-9211095 GGTTAAAAAAAGAAAGTGGGTGG - Intronic
1172453412 20:35045962-35045984 TATTAAAAGAAGAAAGGGTCAGG - Intronic
1173075544 20:39815475-39815497 TATTTCTTGAAGAAAGTGGCTGG + Intergenic
1174062126 20:47840132-47840154 TTCTCCAAGAAGAAACTGGGGGG + Intergenic
1174069378 20:47889099-47889121 TTCTCCAAGAAGAAACTGGGGGG - Intergenic
1177045907 21:16169862-16169884 TATTACAAGCATAGAGTGTGGGG - Intergenic
1178541886 21:33458881-33458903 GATTACAAGAGGACAGTGGTTGG - Intronic
1178691408 21:34753311-34753333 AAATCCAAGAAGAAATTGGGAGG + Intergenic
1181820999 22:25475614-25475636 CATCACAAGAACACAGTGGGTGG - Intergenic
1182851971 22:33483099-33483121 TTTTACAAGTAGAAAGGAGGTGG - Intronic
949093354 3:56097-56119 TATTACAAGAGTAAACAGGGAGG + Intergenic
949249364 3:1964203-1964225 TACTAAAAGAGGAAAGTGGGAGG + Intergenic
949300326 3:2576129-2576151 TATAAAAAGAAGAAAGCGGCTGG - Intronic
950570194 3:13795057-13795079 CATTACAAGAAGGACATGGGAGG + Intergenic
951289708 3:20860834-20860856 GAAAACAAGAAGAAAGTGGTGGG + Intergenic
951299753 3:20980727-20980749 TACTGCAAGAAAAAAGTTGGAGG + Intergenic
953835144 3:46336325-46336347 TTTGAAAAGAAGAAAGTTGGAGG + Intergenic
954102468 3:48386106-48386128 AACTACAAGAAGAAAGTGCAGGG - Intronic
954919482 3:54177343-54177365 TTTTACAAGAAGAATTTGGCAGG + Intronic
954926945 3:54244176-54244198 TTCTACCAAAAGAAAGTGGGAGG - Intronic
955962030 3:64350479-64350501 TGTTGCATGAGGAAAGTGGGTGG + Intronic
957564571 3:81867154-81867176 TTTTTAAAGAAGAAAATGGGAGG + Intergenic
957960093 3:87237847-87237869 TTTTAGAAGAAGAAAGTAGGTGG + Intronic
959348379 3:105228804-105228826 GAATACATGAAGGAAGTGGGAGG - Intergenic
959794473 3:110407726-110407748 AATAAGAAGAAGAAAGTGGGAGG - Intergenic
960251194 3:115455960-115455982 AATTAGAAGAACAAAGTTGGAGG - Intergenic
963554295 3:146768390-146768412 TGTTACAGGAAGACAGTGGTGGG - Intergenic
963622404 3:147627629-147627651 TTTTGCAAGCAGAAAGTTGGAGG + Intergenic
964592193 3:158377320-158377342 TATTTCAACAAGAAATTTGGAGG - Intronic
964598723 3:158470484-158470506 TGTTACAAGATGATGGTGGGGGG + Intronic
965166624 3:165202188-165202210 TATTTTAAGGTGAAAGTGGGAGG - Intergenic
965396662 3:168167403-168167425 TAATAACAGAAGAAACTGGGTGG + Intergenic
966075157 3:175926810-175926832 TTTTAGAAGAAAAAAGTGTGTGG - Intergenic
966082720 3:176024435-176024457 TTTTAAAAGAACAAAGTTGGAGG - Intergenic
966723250 3:183085702-183085724 TCTTACAGGAAGAAAGTGGTAGG - Intronic
969329420 4:6464857-6464879 TATGAAAATAAGAAAGTGTGTGG + Intronic
969880643 4:10170680-10170702 AATTACAAAAACAAAGTGTGGGG - Intergenic
970616619 4:17773924-17773946 TATTAAAACAAGAAAATGAGTGG - Intronic
971659463 4:29393337-29393359 TATTACAAGAACAGACTGGTAGG + Intergenic
972412051 4:38805195-38805217 TATTAAAAGTGGAAAGAGGGAGG + Intronic
973272668 4:48277671-48277693 AAATACAAGAAGGAAGTGGCAGG + Intergenic
974019460 4:56679772-56679794 TATAGCAAAAAGAAAGTGGCTGG - Intronic
974102430 4:57431912-57431934 TTTTACAACAAGAAAGCAGGTGG + Intergenic
975488102 4:74957470-74957492 TATTACCAGAACAAAGTGTAGGG - Intronic
975949103 4:79746589-79746611 TAATACAATTAGAAAGTGGCAGG - Intergenic
975996039 4:80316764-80316786 TTAAAAAAGAAGAAAGTGGGAGG + Intronic
977157096 4:93588209-93588231 TATAAAAAGAAGAAAGGGGGAGG + Intronic
977313480 4:95415249-95415271 GACTAAAAGAAGAAAGTAGGAGG - Intronic
977714659 4:100168313-100168335 AATTACATGAACACAGTGGGAGG + Intergenic
979754488 4:124324348-124324370 TATAAATAGGAGAAAGTGGGGGG - Intergenic
979953765 4:126928237-126928259 TATTATAAACACAAAGTGGGGGG + Intergenic
980581595 4:134761583-134761605 TAGGAGAAGAAAAAAGTGGGAGG + Intergenic
980783926 4:137528217-137528239 TAGGACAAGAAGAAAGGGGTGGG - Intronic
980986368 4:139698927-139698949 TATTACAAGAAAAAATTGAATGG - Intronic
981447646 4:144858678-144858700 TATTAATAGGAGAAAATGGGTGG - Intergenic
981485009 4:145276677-145276699 TAATACAAGAAGGAAGCAGGGGG + Intergenic
981738040 4:147973170-147973192 TATGACAAGAATAAAGCAGGAGG + Intronic
982051522 4:151507125-151507147 TATCTCAAAAAAAAAGTGGGGGG - Intronic
984444406 4:179817003-179817025 TTTTAAAAGAAGAAGGTTGGAGG + Intergenic
984549021 4:181138824-181138846 GATTAAAAGAAGAAGGGGGGTGG - Intergenic
985140382 4:186833460-186833482 TAATACAGGAAGAATATGGGAGG - Intergenic
985285690 4:188334492-188334514 CATTCCAAGGAGAAAGTAGGAGG - Intergenic
987097490 5:14562823-14562845 TGTTACCAGAAGAAAGAGGGAGG - Intergenic
987308028 5:16656556-16656578 TATAGCAAAAAGAAACTGGGTGG + Intergenic
987565288 5:19576141-19576163 TACTAGAAGAAGAAATTGAGGGG + Intronic
988032070 5:25775541-25775563 TAATAAAAGAAGAAAGAAGGAGG + Intergenic
990608221 5:57431203-57431225 TATTAAAAGAAGAAAGGGAGAGG + Intergenic
990684522 5:58286420-58286442 TAATAAAAAAAGGAAGTGGGGGG - Intergenic
990916097 5:60907227-60907249 TATTTCAAGGAGAAAATAGGAGG + Intronic
992371504 5:76148828-76148850 TATTCCTGGGAGAAAGTGGGTGG + Intronic
992462342 5:76972884-76972906 TATCACAGAAAGAATGTGGGTGG + Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993086735 5:83372372-83372394 AACTTCAAGAAGAAAGTGTGAGG + Intergenic
993929434 5:93919760-93919782 TTTTACTATAAGCAAGTGGGAGG + Intronic
994163051 5:96578995-96579017 TATTGCTTGAAGAAAGTGGAAGG + Intronic
994849068 5:105030174-105030196 TATTAGGAGAAGAAAGAAGGAGG - Intergenic
996206129 5:120738493-120738515 TATTAAATGAACAAAGTGGAAGG - Intergenic
996292344 5:121866934-121866956 TATTGGAAGAAGAAAATGGTTGG - Intergenic
997131161 5:131277995-131278017 CATTTCAAAAAAAAAGTGGGGGG - Intronic
997138935 5:131357944-131357966 TGTTTCAAGGAGAAAGTGGGTGG - Intronic
998465314 5:142339117-142339139 TATTTCAAGAAGTAAATGTGAGG - Intergenic
998696712 5:144649030-144649052 TATTACAAGAAACAAGTGCATGG - Intergenic
1000933045 5:167275299-167275321 TTAAAAAAGAAGAAAGTGGGAGG - Intergenic
1001002169 5:168017895-168017917 TATGTCAAGAAGAAAGTGACGGG - Intronic
1001003178 5:168026949-168026971 TATTTCATGTAGAAATTGGGAGG - Intronic
1001558695 5:172655133-172655155 TCCCCCAAGAAGAAAGTGGGGGG + Intronic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1002338603 5:178498791-178498813 TATTAAAAGCAAAAAGTGGCTGG + Intronic
1002555556 5:180036267-180036289 TAGAACAAGAAGAAACTGAGTGG - Intronic
1002760121 6:195201-195223 GATTAGAAGAATAAAGTTGGAGG + Intergenic
1005047251 6:21654035-21654057 TATTAAAAGAATAGGGTGGGAGG - Intergenic
1006916994 6:37601188-37601210 TATCATAAGAAAAAAGTGTGGGG + Intergenic
1007281594 6:40716495-40716517 TATTACAAGAAAAGAGTGCATGG + Intergenic
1007515542 6:42407707-42407729 TTTTAAAAGAAGAAAGGAGGGGG - Intronic
1008578586 6:52884649-52884671 TATTACAAGAAGAAAGTGGGTGG - Intronic
1008598890 6:53069681-53069703 AATTACAAGAAAAAAGAGTGAGG + Intronic
1009413817 6:63395039-63395061 GACTCCAAGAAGAAAGTGTGGGG + Intergenic
1010112717 6:72259741-72259763 TACTTCAAGAAGAAAGTCTGTGG - Intronic
1010504604 6:76641750-76641772 TACTAGAAGAAAAAAGGGGGAGG + Intergenic
1012098153 6:94993057-94993079 TATTGAAAGAAGAGAGTTGGGGG - Intergenic
1012312501 6:97743901-97743923 TTTTAAAAGAAGAAAATTGGAGG - Intergenic
1012363880 6:98416280-98416302 TGTTAGAAGAAGAAAGAAGGTGG - Intergenic
1012491801 6:99790071-99790093 TATTAAAGGAGGAAAGAGGGAGG + Intergenic
1012610098 6:101207254-101207276 TATTGGTAGATGAAAGTGGGGGG - Intergenic
1014416505 6:121190901-121190923 TAGTACTAGGAGAAAGTGGCGGG - Intronic
1014434276 6:121404349-121404371 TGTTACAATAAGAAACTGAGAGG - Intergenic
1015560336 6:134508627-134508649 TATTTCATGAAAAAAGTGGCTGG + Intergenic
1016180786 6:141145699-141145721 TATCATAAGAAGAAATTGGTTGG + Intergenic
1016727812 6:147395795-147395817 GATTACAAGTAGACAGAGGGAGG - Intergenic
1016879042 6:148892443-148892465 TAATACAATAAGAAAGATGGAGG + Intronic
1017106412 6:150892797-150892819 TTTTACAAGAAGAATGTATGGGG + Intronic
1017428203 6:154343977-154343999 TATTAAAAGACTAAGGTGGGAGG + Intronic
1017439613 6:154451619-154451641 TATTACAAAAAGTAAGTGCTGGG - Intronic
1018518986 6:164622971-164622993 TATTATAATAAGAAATTTGGGGG + Intergenic
1019099386 6:169616192-169616214 AATTACAAGAAGAAACTAGCTGG + Intronic
1019321272 7:416408-416430 TATTAAAAAAAAAAAGCGGGGGG + Intergenic
1019884737 7:3893852-3893874 TATTCCAAGTGGCAAGTGGGTGG - Intronic
1020751863 7:12150906-12150928 TATTAAAAGAAGGCAGTGAGAGG - Intergenic
1021177008 7:17460798-17460820 TATTAAAAGACTAAGGTGGGAGG - Intergenic
1021278394 7:18685018-18685040 TTTAACAACAAAAAAGTGGGAGG - Intronic
1021301687 7:18981118-18981140 TATTAAAAGAAGAAACAGGCCGG - Intronic
1021360279 7:19704542-19704564 TATGAAAAGAATAAAGTGGATGG + Intronic
1021800422 7:24299889-24299911 TGTTACAATATGAAAGTGGCTGG - Intergenic
1022050986 7:26671580-26671602 TATTGGAAGAACAAAGTGGAGGG + Intronic
1023113453 7:36837762-36837784 TCTTACAAGAAGATATTTGGGGG - Intergenic
1023772022 7:43566521-43566543 TATTATTAGAAAAAAGTGTGGGG + Intergenic
1024028843 7:45438586-45438608 CATTGCAGGAAGAAAGAGGGTGG - Intergenic
1024818792 7:53303192-53303214 TACTATAAGAAGGAGGTGGGAGG + Intergenic
1025232329 7:57211034-57211056 TTCTCCAAGAAGAAACTGGGAGG - Intergenic
1027887589 7:83929343-83929365 TATTATAAGTAGAAGGTAGGTGG - Intergenic
1028980142 7:96958826-96958848 TATTGCAAGGAGAAAGTGATTGG + Intergenic
1029854512 7:103501719-103501741 TATTACAAAAAGAGAATGGGAGG + Intronic
1030116440 7:106065455-106065477 TATTACAAAAAGAAAAGGAGGGG - Intergenic
1030586858 7:111431600-111431622 TATTAAAACAAAAAAGAGGGTGG + Intronic
1032242760 7:130177626-130177648 CAATACAGGAAGAAAGTGGACGG + Intronic
1032480346 7:132241015-132241037 AATTACCAGGAGGAAGTGGGAGG + Intronic
1033496904 7:141908188-141908210 TATAACAAAAAGAAAGTTGCAGG + Intronic
1033859808 7:145610734-145610756 TACTACATGATGAAAGTTGGGGG - Intergenic
1035893307 8:3370212-3370234 AAATAAAAGAAGAAAGTTGGCGG - Intronic
1035944509 8:3946469-3946491 TTTAAAAAGAACAAAGTGGGAGG - Intronic
1038075157 8:24064907-24064929 TACTAAAAGAAGAAAGTGAAGGG + Intergenic
1039279870 8:35972586-35972608 TTTTATAAGAAGGAAGTAGGGGG + Intergenic
1039564173 8:38538078-38538100 AACTACAAGCAGAAAGGGGGAGG - Intergenic
1040281638 8:46054477-46054499 AATTACAAGAAGAAATTAGCTGG + Intergenic
1040966283 8:53084228-53084250 CATTGCCAGAAGAAAGTGGTCGG - Intergenic
1041754679 8:61300916-61300938 GTTTATAAGAAGAAAGTGGTAGG - Intronic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042500482 8:69503191-69503213 TATTACGTGAAGAAAGTGAATGG + Intronic
1043948765 8:86284281-86284303 AATGAACAGAAGAAAGTGGGAGG + Intronic
1044071485 8:87766079-87766101 TATTAAAAGAAGAAATAGGTAGG - Intergenic
1044435481 8:92157552-92157574 TGCTACAAGAATAAATTGGGTGG - Intergenic
1044529453 8:93290930-93290952 TATTATAAGAAAAAAGGGGCCGG - Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1046868268 8:119174942-119174964 TATTAGAAAAAACAAGTGGGAGG + Intronic
1046876349 8:119259001-119259023 TATCACAAGATGAGAGGGGGAGG + Intergenic
1047273393 8:123384248-123384270 TATAACAAAAAAAAACTGGGTGG + Intronic
1047343775 8:124007521-124007543 AATTCCAAGAAGGAAGTGGGTGG - Intronic
1047790921 8:128202907-128202929 TCCGACAAGAAGAAAGGGGGAGG + Intergenic
1048692738 8:136986445-136986467 TATTAAAGAAAGAAAGTTGGGGG - Intergenic
1049028187 8:140012147-140012169 TTTTAGAAGAAAGAAGTGGGGGG + Intronic
1050313841 9:4380964-4380986 AATTAGAAGAAAAATGTGGGAGG + Intergenic
1050421377 9:5468798-5468820 TATTATAAAAGGACAGTGGGTGG - Exonic
1050681480 9:8116838-8116860 TATTACAGGAAGAACTTTGGTGG - Intergenic
1050858038 9:10386921-10386943 CATTACAAGATGGAAGAGGGAGG + Intronic
1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG + Intergenic
1052174392 9:25440418-25440440 TATAAAAAGAAGAGAGTGAGAGG + Intergenic
1052763088 9:32612599-32612621 GATTATAAGCAGGAAGTGGGGGG - Intergenic
1053232590 9:36423502-36423524 TATAACACGCAGAAAATGGGAGG + Intronic
1055160655 9:73122582-73122604 GATTACAAGAAGACATTTGGAGG + Intergenic
1055453360 9:76451254-76451276 TATTGCAAGAAGAGGATGGGTGG + Intronic
1055490954 9:76804912-76804934 TATTAAATGAAGACAGTGTGAGG - Intronic
1056583406 9:87912223-87912245 AAATAGAAGAATAAAGTGGGAGG + Intergenic
1056583930 9:87915854-87915876 AAATAGAAGAATAAAGTGGGAGG - Intergenic
1056612939 9:88137066-88137088 AAATAGAAGAATAAAGTGGGAGG + Intergenic
1056613439 9:88140560-88140582 AAATAGAAGAATAAAGTGGGAGG + Intergenic
1057159686 9:92880302-92880324 AAATAGAAGAATAAAGTGGGAGG + Intergenic
1059186860 9:112282087-112282109 GATTACATGATGAAGGTGGGTGG - Intronic
1059187240 9:112285172-112285194 TATCACAAGAAGAGCATGGGGGG - Intronic
1060288503 9:122277154-122277176 AATTAAAAGAAGAAACTGGCTGG - Intronic
1061819162 9:133215468-133215490 TTTTTTAAGAATAAAGTGGGAGG + Intergenic
1186541259 X:10402895-10402917 TTTTTCAAGAACAAAGTTGGAGG - Intergenic
1186617212 X:11201869-11201891 CAATACAAGATGAGAGTGGGTGG + Intronic
1187000727 X:15174450-15174472 TATTACAAAAACCAAGAGGGTGG + Intergenic
1187240690 X:17510424-17510446 TATTCCAACAAGAAAGCAGGAGG - Intronic
1188103240 X:26116792-26116814 TGTGACAAGAAGAAACTGGATGG - Intergenic
1190374047 X:49771568-49771590 TACTACAAGAAAATATTGGGGGG - Intergenic
1190737723 X:53266798-53266820 AATTCCAAGAAGAAGGTGGGGGG + Intronic
1192808310 X:74528964-74528986 GATTAAAAAAAGAAAGTTGGGGG - Intronic
1193317438 X:80079908-80079930 GAATACAAGAAGAGAATGGGAGG + Intergenic
1193694212 X:84687122-84687144 TATCATAAGAATAAAGTGAGTGG + Intergenic
1193956325 X:87868457-87868479 TATTATAAGAATAAAGATGGTGG - Intergenic
1193971752 X:88063781-88063803 AATTACTAGAGGGAAGTGGGTGG + Intergenic
1195136597 X:101913015-101913037 TGTTAGAAAAAAAAAGTGGGGGG + Intronic
1195160221 X:102163518-102163540 TATCACACGATGAAAGTGGGAGG + Intergenic
1195832971 X:109080516-109080538 TAAAACAAGGAGAAAGTGGAAGG - Intergenic
1195882725 X:109609708-109609730 TATTAGAAGAAGCAACTTGGAGG - Intergenic
1196158246 X:112454389-112454411 TATTACAAGGAAAAGGAGGGAGG + Intergenic
1196434208 X:115660109-115660131 TATTACCAGCAGAAAGGGAGTGG + Intergenic
1197235545 X:124058445-124058467 TACTAGAAGAAGAAAGTGACCGG - Intronic
1197583594 X:128315363-128315385 TATTAAAAAAAGAAAGATGGTGG + Intergenic
1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG + Intergenic
1200426416 Y:3025656-3025678 TACTACTATAAGATAGTGGGGGG - Intergenic
1201464504 Y:14265802-14265824 TATTACAAGACCATAATGGGTGG - Intergenic