ID: 1008578624

View in Genome Browser
Species Human (GRCh38)
Location 6:52885192-52885214
Sequence CCATTGTGGTAGTAGAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008578612_1008578624 30 Left 1008578612 6:52885139-52885161 CCCGTACTCCAGATGCAGCTAGG 0: 1
1: 0
2: 1
3: 13
4: 107
Right 1008578624 6:52885192-52885214 CCATTGTGGTAGTAGAGCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 103
1008578618_1008578624 -9 Left 1008578618 6:52885178-52885200 CCATTCTGCCCTGTCCATTGTGG 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1008578624 6:52885192-52885214 CCATTGTGGTAGTAGAGCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 103
1008578615_1008578624 22 Left 1008578615 6:52885147-52885169 CCAGATGCAGCTAGGAGCGACTG 0: 1
1: 0
2: 3
3: 2
4: 84
Right 1008578624 6:52885192-52885214 CCATTGTGGTAGTAGAGCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 103
1008578614_1008578624 29 Left 1008578614 6:52885140-52885162 CCGTACTCCAGATGCAGCTAGGA 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1008578624 6:52885192-52885214 CCATTGTGGTAGTAGAGCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008578624 Original CRISPR CCATTGTGGTAGTAGAGCTT GGG Intronic
900463114 1:2810721-2810743 CCATTGTGGTGGGAGACCCTGGG + Intergenic
900706648 1:4084933-4084955 CCCTTGTGGGAGAAGAGCTGAGG + Intergenic
901060248 1:6468535-6468557 CCATGGTTGTGGTAGAGCCTGGG - Exonic
902975445 1:20084945-20084967 CCATTGAGGTCGTAGAGACTTGG + Intronic
907593550 1:55698972-55698994 CAGTTGTGATAATAGAGCTTTGG + Intergenic
912075577 1:105871378-105871400 CCATTGTGGATGTTGGGCTTGGG - Intergenic
922003212 1:221502191-221502213 CCATTGAGTTATTAGACCTTTGG - Intergenic
924329663 1:242929100-242929122 ACATTGTGTTAGTGGGGCTTTGG - Intergenic
924528459 1:244872849-244872871 CCTTTGTGGAAGTTGAGTTTTGG - Intergenic
1065116291 10:22486347-22486369 CATTTTTGGTAGCAGAGCTTTGG - Intergenic
1065671981 10:28129116-28129138 CAATTGTGGTAAGAGAGGTTTGG - Intronic
1066466364 10:35653808-35653830 CCCTTGTGGTCCTAGTGCTTTGG + Intergenic
1078845902 11:15118134-15118156 CCCTTGTGGAACTGGAGCTTGGG + Intronic
1081778916 11:45696435-45696457 CCACAGTGGCAGTTGAGCTTCGG - Intergenic
1082663019 11:55937888-55937910 TCATTGTTGTAGTATAGATTAGG - Intergenic
1087314864 11:96591273-96591295 GCTTTGTGGTAGTACAGCCTAGG - Intergenic
1089074897 11:115729915-115729937 CAGTTGTGGAATTAGAGCTTTGG + Intergenic
1095174847 12:39079796-39079818 CCAGTGTGATAGTGGGGCTTTGG - Intergenic
1095780653 12:46055355-46055377 CCATTCTGGAAATAGAACTTGGG + Intergenic
1097622749 12:61961260-61961282 CCATTGTTGGAGTAGCGGTTGGG - Intronic
1098629242 12:72706699-72706721 GCTTTGTGGCAGTACAGCTTAGG - Intergenic
1100243654 12:92734926-92734948 CCATTGTGGTGGCAGTGGTTAGG - Intronic
1100561543 12:95752509-95752531 GCTTTGTGGCAGTAGAGCCTAGG - Intronic
1100572118 12:95852629-95852651 CCAGTGTGGTAGTGGATGTTAGG - Intergenic
1100958859 12:99940193-99940215 GCATTGTGGGAGTATAGATTAGG - Intronic
1101245467 12:102880204-102880226 CCACTGAGGAAGGAGAGCTTGGG - Intronic
1104283481 12:127400389-127400411 TCTTTGTGGTATGAGAGCTTTGG + Intergenic
1104368492 12:128199830-128199852 CCATTGTGGTAGAAGAAGTTAGG - Intergenic
1104613235 12:130247077-130247099 CCATTGTGGTAGTAATGCAGTGG + Intergenic
1108715135 13:53071392-53071414 CCAGTATGGTAATAGAGCCTGGG + Intergenic
1110198905 13:72825152-72825174 CCATTATGGTAATAGAGCCTTGG + Intronic
1110499012 13:76204284-76204306 CCTGTGTGGTAGTAGAATTTCGG - Intergenic
1115809368 14:37089690-37089712 CCATTGAAGAAGTAGAGCTGTGG - Intronic
1118488451 14:66235764-66235786 CCAAGGTGGGAGTATAGCTTGGG - Intergenic
1121526295 14:94621698-94621720 TGATTGTGTTAGAAGAGCTTTGG - Intronic
1128220599 15:65965674-65965696 CCATTTTGGAAGCAGAGATTGGG + Intronic
1138275966 16:55734959-55734981 CCAATGTGGTCTTGGAGCTTAGG + Intergenic
1138286989 16:55818033-55818055 CCAATGTGGTATTGGTGCTTAGG - Intronic
1140891746 16:79290875-79290897 CCATTTTGGGGGTAGAGATTGGG - Intergenic
1143432629 17:6898371-6898393 CCATGGAGGAAGGAGAGCTTGGG - Intronic
1158261788 18:55613776-55613798 CCAATGTTGTAGGAGAGATTTGG - Intronic
1163367503 19:16883913-16883935 CCATGGTGGAAGCAGGGCTTGGG - Intergenic
1166275651 19:41752002-41752024 CCATTTGGGTAGCAGACCTTTGG + Intronic
927096586 2:19751791-19751813 CCAGTGTGGGAGTAGTTCTTTGG - Intergenic
927583758 2:24280250-24280272 CCTTTGTGATAGTAGAGCACCGG - Intronic
929872252 2:45769022-45769044 CCATTTTGGCAGCAGAGCTGTGG + Intronic
933668231 2:84982268-84982290 CCTCTGTGGTTGTAGAGGTTTGG + Intronic
933709881 2:85317089-85317111 CCAGTGTGGTTCTGGAGCTTTGG + Intergenic
933713178 2:85342635-85342657 CCAGTGTGGTTCTGGAGCTTTGG - Exonic
935536002 2:104295258-104295280 CCATAGTGGGATTAGAGGTTGGG - Intergenic
936748401 2:115609650-115609672 CCATTCTACTAGTAGAGTTTGGG + Intronic
936832357 2:116663114-116663136 CCATTGAGGCAGTACTGCTTTGG - Intergenic
938560824 2:132470589-132470611 CCATTGTGGTTGTTGAGCTGTGG + Intronic
939155094 2:138515281-138515303 GCATTGTGTAATTAGAGCTTTGG - Intronic
944379983 2:199097326-199097348 TCCTTGTGGTGGTAGAGCTAAGG - Intergenic
948228065 2:236328355-236328377 CCATGGAGGTAGTACAGATTTGG + Intronic
1168920090 20:1525315-1525337 CACTTGTGTTAGTAGATCTTTGG + Intergenic
1173238995 20:41276492-41276514 CCAATGTGGTAGTAGCTCTCTGG + Intronic
1173271867 20:41543708-41543730 CGATGGTGGTTGTAGATCTTTGG - Intronic
1177319952 21:19508585-19508607 CCACTGGGGAAGTAGAGCCTTGG - Intergenic
1178232866 21:30807079-30807101 CCATTTTGGTAGAAGTTCTTAGG + Intergenic
1178907378 21:36647841-36647863 CCATGGCTGTAGTGGAGCTTTGG - Intergenic
1181059297 22:20274186-20274208 CCATGGTGGGAGCAGAGCCTGGG + Intronic
1183296585 22:37033370-37033392 CCATTGTGCTTATAGAGCTGAGG - Intergenic
955379482 3:58425557-58425579 CCATTGTGGTTATAGAACTCAGG + Intronic
955860766 3:63327737-63327759 ACATTGTGGTATTAGAAGTTAGG + Intronic
956690444 3:71873429-71873451 CCATTCTCGAAGTAGAGGTTAGG - Intergenic
965506499 3:169521133-169521155 CCACTGTGGCAGAACAGCTTGGG + Intronic
969197342 4:5573494-5573516 CCATTGTGGTTGTAGGACTGAGG - Intronic
971815873 4:31488062-31488084 TCATTGTGGAAGTAGAGCACTGG - Intergenic
978297900 4:107229728-107229750 CCATTGTGGTTAAAGATCTTTGG - Intronic
981709544 4:147695566-147695588 CCATCTTGGTAGCAGAGCCTGGG - Intergenic
982254154 4:153435912-153435934 CCATTGTGGGGGTAAAGGTTCGG - Intergenic
986427204 5:7645517-7645539 CCAGTGTGGTATAAGAACTTTGG + Intronic
992540861 5:77762419-77762441 TAATTGTGGTAGTAGTGCTGAGG + Intronic
995013526 5:107285008-107285030 ACATTGTGGTGGTAAAGCTCTGG - Intergenic
996037023 5:118769754-118769776 CCATTGTTGTTTTGGAGCTTTGG - Intergenic
997764304 5:136484565-136484587 GCATTGTGGTTATAGAGCTTGGG - Intergenic
1000439900 5:161251839-161251861 GCCTTGTGGTAGTACAGCCTAGG - Intergenic
1001842162 5:174887048-174887070 ATATTGTGGTAGGAAAGCTTTGG + Intergenic
1005041207 6:21602109-21602131 CCATGGTGGTAGTCCAGCTGGGG - Intergenic
1005842644 6:29753806-29753828 TCATTGTGGTAGTGGAGATGTGG - Intergenic
1008025410 6:46630386-46630408 CCACTGTGGTCTTAGAACTTGGG - Intronic
1008558865 6:52703791-52703813 CCATTGAAGTAGTAAAGCTTGGG + Intergenic
1008569235 6:52799233-52799255 GCATTGAAGTAGTGGAGCTTGGG + Exonic
1008573902 6:52840779-52840801 GCATTGGAGTAGTGGAGCTTGGG + Exonic
1008577000 6:52870295-52870317 GCATTGGAGTAGTGGAGCTTGGG + Intronic
1008578624 6:52885192-52885214 CCATTGTGGTAGTAGAGCTTGGG + Intronic
1008580887 6:52905800-52905822 CCATTGAAGTAGTGAAGCTTGGG + Exonic
1008586743 6:52957532-52957554 CCATGAAAGTAGTAGAGCTTGGG + Intergenic
1008591027 6:52994209-52994231 CCGTTGGGATAGTGGAGCTTGGG + Exonic
1015315411 6:131810872-131810894 CCATTGTGGTGGTTGATCTTAGG + Intronic
1023481339 7:40637871-40637893 CCAATGTGGAAGGAAAGCTTTGG + Intronic
1026510690 7:71025051-71025073 CCAATGTGGGAGGATAGCTTGGG - Intergenic
1030297581 7:107944381-107944403 CCAATGAGCTAGCAGAGCTTCGG + Intronic
1032457057 7:132081161-132081183 CCATTCTGGCATAAGAGCTTTGG - Intergenic
1043421639 8:80104319-80104341 CCATTCTTTTAGAAGAGCTTAGG - Intronic
1044093153 8:88027444-88027466 CTATAGTTTTAGTAGAGCTTTGG + Intergenic
1046358920 8:113125002-113125024 CCAGTATGTTTGTAGAGCTTTGG - Intronic
1047821511 8:128526240-128526262 CCATTGTGGTAGTGGTGCTGGGG + Intergenic
1051543279 9:18245345-18245367 CTATTGTGATAGTAAATCTTAGG + Intergenic
1052866454 9:33467272-33467294 CAAGGGTGGTAGTAGAGCTGGGG + Intronic
1055543052 9:77335055-77335077 ACATTTTAGGAGTAGAGCTTAGG + Intronic
1056142863 9:83700449-83700471 CCATTGTGTTACCAGAGCCTAGG - Intronic
1056736491 9:89214562-89214584 CCATTGTGGTAGGAATGCTGAGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1191716440 X:64196979-64197001 CCATTGAGGAAGGATAGCTTTGG - Intronic
1195328351 X:103776322-103776344 CTATTGTGTTCGTAGAGCTGGGG + Intronic
1195702175 X:107713943-107713965 CCAGTGTGGGATTACAGCTTTGG - Exonic
1197188450 X:123616258-123616280 CCAGTATGGTAGAAGAGCTAAGG + Intronic
1201227028 Y:11828228-11828250 ACATTGTGTTAGTGGGGCTTTGG - Intergenic