ID: 1008579769

View in Genome Browser
Species Human (GRCh38)
Location 6:52896235-52896257
Sequence CAGGGTGGCCTGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 2, 1: 2, 2: 5, 3: 55, 4: 513}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008579762_1008579769 5 Left 1008579762 6:52896207-52896229 CCAGGAGCACATGCACTGTAAGG 0: 3
1: 1
2: 3
3: 6
4: 143
Right 1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG 0: 2
1: 2
2: 5
3: 55
4: 513
1008579760_1008579769 30 Left 1008579760 6:52896182-52896204 CCTTAAGGAGCAGAGTGAGGATG 0: 3
1: 1
2: 1
3: 24
4: 231
Right 1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG 0: 2
1: 2
2: 5
3: 55
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008579769 Original CRISPR CAGGGTGGCCTGAGAGCAGA GGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900502868 1:3015201-3015223 CAGGGTGGCATCAGCGCACAGGG - Intergenic
900531670 1:3156862-3156884 CCGTGTGGCCTGAGAGAAGCAGG + Intronic
900564758 1:3326788-3326810 CCGCGTGGCCTGACAGCAGGGGG + Intronic
900646808 1:3712800-3712822 CAGGGTCACCTGTCAGCAGAGGG + Intronic
900933840 1:5753143-5753165 TAGGGTGTCCTGGCAGCAGATGG - Intergenic
901757102 1:11448084-11448106 CAGGGCGGCCTGAGGGCTGGGGG + Intergenic
901776936 1:11566555-11566577 CAGGACTGCTTGAGAGCAGATGG - Intergenic
901846249 1:11984622-11984644 TAGGGTGGAAGGAGAGCAGAAGG - Intronic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
901927953 1:12578948-12578970 CTTGGTGGTCTGAGGGCAGATGG + Exonic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902082063 1:13827999-13828021 CAAGGTGGCCTGAGATCATCAGG - Intergenic
902278804 1:15359412-15359434 CAGGGTGAGGTGGGAGCAGAAGG + Intronic
902603550 1:17556131-17556153 CAGGGGGGCCTGGGAGCATATGG + Intronic
902891528 1:19447764-19447786 CAGTGTGGCCTGCGAGCTGCTGG - Intronic
903173195 1:21566078-21566100 CAGGGTGGGCTGGGAGAAGAAGG - Intronic
903351774 1:22721196-22721218 CAGGCTGGCCCCAGAGCACATGG + Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904925090 1:34041315-34041337 CAGTGTGGACTGAGACCTGAGGG + Intronic
906041850 1:42793756-42793778 CAAGGTTGCCTTAGAACAGAGGG + Intronic
906215364 1:44035190-44035212 CAGGCTGGGCTGAGGCCAGAGGG - Intergenic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906543288 1:46604339-46604361 CAGGGCCGCCTGAGGGCAGGGGG + Intronic
907045784 1:51299320-51299342 CAGGCTTGCCTGTCAGCAGATGG - Intronic
907098045 1:51799783-51799805 GGGGGTTGCCTGTGAGCAGAGGG + Intronic
907495597 1:54842136-54842158 CATGGGGGCCAGAGAGCAGATGG + Exonic
909054734 1:70807364-70807386 CTGGGTTCCCTGAGAGCACAGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
912358405 1:109074043-109074065 CAGGGTGGCGGCAGGGCAGAGGG - Intronic
912454640 1:109789300-109789322 TAGGGTGGCCTGAGAGTAAGGGG - Intergenic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
913174468 1:116261599-116261621 CAGTCTGGCCTGAGGGCACAGGG - Intergenic
914048287 1:144108359-144108381 CACGGTGGCCTGGGAGGACAGGG + Intergenic
914130897 1:144857089-144857111 CACGGTGGCCTGGGAGGACAGGG - Intergenic
914716525 1:150258916-150258938 GTGGGTGTCCAGAGAGCAGAAGG + Intronic
914860532 1:151382123-151382145 TAGGGTGGACTGAGGGGAGAGGG - Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
916120662 1:161525488-161525510 CAGGGTGGCCTGGGTGCTGGAGG - Exonic
916130428 1:161607120-161607142 CAGGGTGGCCTGGGTGCTGGAGG - Intronic
916234928 1:162577536-162577558 GAGGATGGCTTGAGACCAGAAGG - Intronic
916256086 1:162789588-162789610 CAGTTTGGTCTGAGAACAGAAGG + Intergenic
916983914 1:170169779-170169801 AAGGGTGGCTTGAGAGAAGTTGG + Intergenic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
918215974 1:182392032-182392054 CCGGGAGGGCTGAGGGCAGAGGG + Exonic
919329711 1:196155750-196155772 CAGGGCGGTCTGTGATCAGATGG - Intergenic
920188577 1:204177920-204177942 TAGGGTTTGCTGAGAGCAGAGGG - Intergenic
920354435 1:205360161-205360183 AAAGGAGGCCAGAGAGCAGAGGG + Intergenic
922079269 1:222279083-222279105 CTGGCTGTCCAGAGAGCAGAAGG + Intergenic
922572409 1:226641945-226641967 CAGGGTGGCCGTGGAGCTGATGG + Exonic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923519034 1:234721862-234721884 CTGGCTGGCCTTAGAGCAAATGG - Intergenic
924073847 1:240312188-240312210 GTGGGTGGCTGGAGAGCAGAGGG - Intronic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
1062984549 10:1755477-1755499 CAGGATGGCCTTAGAGTCGAGGG - Intergenic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1064335298 10:14435184-14435206 CAGGGTGGGATGAGGGCAAAAGG + Intronic
1065520867 10:26570562-26570584 GAGGGTGGCTTGAGTCCAGAAGG - Intergenic
1065681518 10:28238630-28238652 CAGGGTGTCCGGAGAGCGGTGGG - Exonic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1066094556 10:32059710-32059732 CAAGGTGGCCTGTAAGCAGCTGG - Intergenic
1066559031 10:36648005-36648027 CAGGGTGGCCACACAGCAGTAGG + Intergenic
1067028517 10:42864933-42864955 CAGGTCTGTCTGAGAGCAGAGGG - Intergenic
1067221366 10:44346555-44346577 TAGGGTGGCCTGAGCGGAGTAGG + Intergenic
1067742425 10:48905715-48905737 ATGGGTGGCCTCAGAGCCGAGGG - Intronic
1068966722 10:62919186-62919208 AAGCTTGGCCTGAGAACAGACGG + Intronic
1070633750 10:78107275-78107297 CAGGCTGGCCTGAGAGGAAGAGG + Intergenic
1070780625 10:79135642-79135664 CTGGGTGGCCAGAGAGCTAAGGG + Intronic
1070820629 10:79352102-79352124 TGGGGTGGCCTGAGAGGACAGGG - Intronic
1071548558 10:86547759-86547781 CAGGATGGCTTGAGCCCAGAAGG + Intergenic
1072662080 10:97369372-97369394 CAGGGTGGCCTCTGAGCTGTTGG - Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1072914029 10:99526395-99526417 CAGGCATCCCTGAGAGCAGATGG - Intergenic
1074870196 10:117570112-117570134 CAGGGTTTCCTGAGAGGAGCTGG - Intergenic
1074987261 10:118669338-118669360 CAGCGTGGCCTGGGAGAAAAAGG + Intergenic
1075510975 10:123072923-123072945 CAGGGCAGCCTGAGCACAGATGG + Intergenic
1075991624 10:126843220-126843242 CAGGGAGGGCTGGGAGCTGAGGG + Intergenic
1076048511 10:127313780-127313802 CAGGTTCGCCTGAGGGCTGAGGG + Intronic
1076544953 10:131238947-131238969 CAGGGAGGCAGGAGAGCAGCAGG - Intronic
1076865260 10:133163457-133163479 CAGGATGAGCTCAGAGCAGAAGG + Intronic
1077163423 11:1124078-1124100 CAGGGTTGCCTATGAGCAGAGGG - Intergenic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078550956 11:12280356-12280378 CAGGCTTGGCTCAGAGCAGAAGG - Intronic
1079130148 11:17742496-17742518 CAGGCTGGCCCCAGAGCTGATGG - Intronic
1079959564 11:26906428-26906450 GAGGGTTGCTTGAGAGCAGGAGG - Intergenic
1080290612 11:30666963-30666985 CAGGGAGTCATGAGAGCAAATGG + Intergenic
1080292045 11:30681827-30681849 CATAGTGGCCTGAAAGCACAAGG + Intergenic
1081038279 11:38177226-38177248 CAGGGTGGGCTGAGCGAACAGGG + Intergenic
1081818635 11:45968974-45968996 GAGGGTAGTCTGAGAGCACATGG - Intronic
1083592564 11:63904174-63904196 TAGGGTGGGCTGAGGGCAGCAGG - Intronic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1084173769 11:67412981-67413003 CTGGGTGGCCTGAGCGCCCATGG - Intronic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1084485837 11:69447661-69447683 CAGGGAGGCCCCAGAGCTGAGGG - Intergenic
1084504625 11:69557571-69557593 AATGGAGGCCTCAGAGCAGACGG - Intergenic
1084553925 11:69864792-69864814 GAGGGTGACCTCTGAGCAGAGGG + Intergenic
1084770056 11:71336814-71336836 CAGGGAGGCTGGAAAGCAGAAGG - Intergenic
1084835567 11:71799558-71799580 CAGGCTGGACTGGGATCAGATGG + Exonic
1086964629 11:93015045-93015067 CATGGAGGCATGAGAGAAGATGG - Intergenic
1088771302 11:113038267-113038289 CAAGGAGGCCAGAGAGCAGTGGG - Intronic
1089465092 11:118679784-118679806 CACTGTGCCCTGAGAGCAGGAGG - Intergenic
1089586632 11:119513659-119513681 CTGGGGGCCCTGTGAGCAGATGG + Intergenic
1090017199 11:123096917-123096939 GAGGATCGCCTGAGTGCAGAAGG - Intronic
1090400877 11:126447484-126447506 GAGGGTGGCCTGAGAGCACCGGG - Intronic
1090610140 11:128463711-128463733 CTGGATGGGCTGAGAGAAGAGGG - Intronic
1090719583 11:129459378-129459400 CTGGGCTGCCAGAGAGCAGACGG + Intergenic
1091794069 12:3287376-3287398 CATGGGGGTCTGAGAGCAGTTGG + Intergenic
1091890551 12:4050504-4050526 GTGGGTGGCCTGACCGCAGATGG - Intergenic
1092086433 12:5766764-5766786 TAGTCTGGCCTGAGAGCAGAGGG - Intronic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1094484254 12:30911858-30911880 CAGGCCTGCCTGGGAGCAGATGG - Intergenic
1096514264 12:52147585-52147607 CACGGCGCCCTGAGAGCGGAGGG + Intergenic
1097661568 12:62436157-62436179 CAGGAGGGCCTGAGAGCTGCAGG + Intergenic
1098845916 12:75535533-75535555 CAGGGTGGCCTTGGTGCAGTTGG + Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1099933735 12:89101667-89101689 GAGGATGACTTGAGAGCAGATGG + Intergenic
1101753267 12:107600860-107600882 CAGGGAGGGCTGGGATCAGAGGG + Intronic
1102162504 12:110781124-110781146 CAGGATGACCTGAGCCCAGAAGG + Intergenic
1102465999 12:113131175-113131197 CAGGGAGGCCTGAGGCCAGCAGG + Intronic
1103572779 12:121856289-121856311 CTGGGTGGACTGAGAGAGGAAGG - Intronic
1103927440 12:124430733-124430755 CATGGAGGCCTGGGAGAAGAAGG - Exonic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1103946744 12:124531468-124531490 GAGGGTGGCCTGTGGGGAGAAGG + Intronic
1104935059 12:132360093-132360115 CAGGGTGTCCCCAGAGGAGAAGG + Intergenic
1105310113 13:19198992-19199014 GAGGAGGGCCTGAAAGCAGAAGG + Intergenic
1105496988 13:20939031-20939053 CAGGGTGGAGTGAGTGCAGTGGG - Intergenic
1105527358 13:21188281-21188303 GAGGAGGGCCTGAAAGCAGAAGG - Intergenic
1108225672 13:48286501-48286523 CAGTGTGGCCTGGAAGCAGATGG + Intergenic
1108418509 13:50225366-50225388 AAGGGTGGCCTGGGAGAAGGGGG + Intronic
1110590530 13:77251875-77251897 CAGGGTGTTTGGAGAGCAGAGGG - Intronic
1112378537 13:98866099-98866121 CAGGGTGGCCAGATAACAGTTGG - Intronic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113150754 13:107261262-107261284 CAGTGTGGAGTAAGAGCAGAGGG - Intronic
1113662083 13:112114607-112114629 CAAGGTGGCCTCTGAGCAAAGGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114375675 14:22144068-22144090 CAGGGTGGACTCAGAGTGGAAGG + Intergenic
1115502543 14:34062484-34062506 CAGGGTGGGGTTAGAGCAGAGGG - Intronic
1117066244 14:52015265-52015287 CTGGGTGGGCTCTGAGCAGATGG + Exonic
1117442571 14:55773709-55773731 CACAGTGGTCTGAAAGCAGAAGG - Intergenic
1117904382 14:60569102-60569124 CAGGGATGGCAGAGAGCAGAAGG + Intergenic
1119206375 14:72797133-72797155 CAGGGTTCCCGGAGAGCAGAAGG - Intronic
1119835826 14:77747878-77747900 CGGGGTGGCCTCTGGGCAGAGGG - Intronic
1119946824 14:78704059-78704081 CAGAGTGGCCTGGGATAAGATGG + Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121629183 14:95410177-95410199 CAGGGTCCCCTGAGAGGAGGTGG + Intronic
1121814755 14:96920683-96920705 GAGGGTGGCCTGGGAGCTGCTGG - Intronic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122416764 14:101553514-101553536 CAGGGTAGTCTGGGGGCAGAAGG - Intergenic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1123104681 14:105835078-105835100 AGGGTTGGCCTGAGAGAAGACGG + Intergenic
1123492163 15:20789543-20789565 GAGGGTGGCTTGAGACCAGGAGG - Intergenic
1123548665 15:21358633-21358655 GAGGGTGGCTTGAGACCAGGAGG - Intergenic
1123806266 15:23877187-23877209 CATCCTGGCCTGAGAACAGAAGG + Intergenic
1125957576 15:43800807-43800829 CGGGGCGGGCTGAGAGCAGAGGG + Intronic
1126846494 15:52765376-52765398 CAGGTAGGGGTGAGAGCAGAGGG - Intronic
1127525978 15:59792257-59792279 AAGGGGGTCCTGAGAGCAGCTGG - Intergenic
1128458232 15:67845220-67845242 CAGGATGGCCTAAGGGCATAAGG + Intergenic
1128806663 15:70536202-70536224 GAGGGTGGCCTGGGTGCAGGAGG - Intergenic
1128925552 15:71652023-71652045 CAGGGCCTCCTGAGCGCAGATGG - Intronic
1129167543 15:73787293-73787315 CAGGGGGGCCTGGGAGGTGAGGG + Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129384690 15:75189452-75189474 GTGGGAGGCCTGAAAGCAGAGGG + Intergenic
1129523741 15:76201313-76201335 CAGAGTGGCCTGAGAGTGGGAGG - Intronic
1129709623 15:77813934-77813956 CAGGGTTGCCTGGGAGGTGAAGG + Intronic
1129737610 15:77974890-77974912 CTGGGTGGCCTTAGGGCAGGTGG - Intergenic
1129848463 15:78778729-78778751 CTGGGTGGCCTCAGGGCAGGTGG + Intronic
1130258028 15:82334837-82334859 CAGGGAGGCCTGTCTGCAGAGGG + Intergenic
1130596904 15:85255126-85255148 CAGGGAGGCCTGTCTGCAGAGGG - Intergenic
1130992020 15:88881308-88881330 CACTGGGACCTGAGAGCAGAGGG - Intronic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131508425 15:93035681-93035703 CAGGGCGGCCTGAGGAGAGATGG + Intronic
1131636527 15:94238700-94238722 CAGGGTGCTATGAGAGCAGGTGG + Intronic
1132029917 15:98430925-98430947 CAGGGTGGGCCAAGAGCAGATGG + Intergenic
1132336469 15:101051424-101051446 CTGGGGGGCCTGAGAGGAGTGGG - Intronic
1202957001 15_KI270727v1_random:85864-85886 GAGGGTGGCTTGAGACCAGGAGG - Intergenic
1132465271 16:74580-74602 CAGGGTGGGCTGAGAGCCTGGGG - Intronic
1132624180 16:882419-882441 CTTGGTGGCCTCAGAGTAGAGGG - Intronic
1133100779 16:3478337-3478359 CAGGGTTGCCTGAGAGCCAGTGG + Intronic
1133472684 16:6090823-6090845 GAGGGAGGGGTGAGAGCAGAGGG + Intronic
1134074955 16:11284179-11284201 CAGGGAGGCCAGTGATCAGAAGG - Intronic
1135046917 16:19163495-19163517 CAGGGAGGCCAGTGAGGAGATGG - Intronic
1135221768 16:20620774-20620796 CAGGGTGCCCTGAGAGGACCAGG - Intronic
1135510814 16:23081497-23081519 CAGGGTGGGCTGCTAGTAGATGG - Intronic
1135652787 16:24221308-24221330 CAGGGAGGCCCAAGAGAAGAGGG + Intergenic
1135922931 16:26667517-26667539 CAGGGTTCCCACAGAGCAGAAGG + Intergenic
1136174866 16:28509629-28509651 CAGGGAGCCCTAAGAGAAGATGG - Intronic
1136380003 16:29888802-29888824 AAGGTTGGCCTGAAAGGAGAGGG - Intronic
1136515012 16:30762722-30762744 CAGTTTGGCCAGAGAACAGAGGG - Intronic
1136984261 16:35084549-35084571 CAGGGAGGTCTCGGAGCAGAAGG + Intergenic
1137298425 16:47121265-47121287 CATGGTGGGCTGTGAGCATAGGG + Intronic
1137708130 16:50548992-50549014 GAGGGTGCCGTGAGAGCCGAGGG - Intronic
1137783676 16:51119548-51119570 TTGGGAGGCCTGAGAGAAGAAGG - Intergenic
1140068338 16:71627876-71627898 CACGGTGAACTGTGAGCAGATGG + Intronic
1140288008 16:73622749-73622771 CAGGGTGCCCTTAGAGCTGCTGG - Intergenic
1140693429 16:77507530-77507552 CAGGGTGGAGGGAGAGCAGGGGG + Intergenic
1140835390 16:78789184-78789206 CATGGTGGTGTGAGAGCAGAAGG + Intronic
1141107374 16:81244640-81244662 TCGGGTGGGCTGAGAGCAGGAGG - Intronic
1141606820 16:85158668-85158690 CATGGGGGTCTGAGACCAGAGGG - Intergenic
1141696572 16:85622952-85622974 CTGGCTGGCCTGAGACCATAGGG + Intronic
1141713152 16:85711826-85711848 AAGGGAGGCCTGAGAACAGTAGG - Intronic
1141962399 16:87417855-87417877 CAGGGTGGCCTGTGACAACAGGG - Intronic
1142079777 16:88142902-88142924 CACAGGGGCCTGAGAGCACAGGG + Intergenic
1142107778 16:88315582-88315604 CAGGGAGGCCTGAGAGCTCCTGG - Intergenic
1142176410 16:88647447-88647469 GAGGGTGGCCTGAGCCCAGGTGG + Intronic
1142303788 16:89274434-89274456 CTGGGGTGCCTGAGAGCAGCAGG + Intronic
1142304542 16:89278184-89278206 CTGGGGGGCCTGAGAACAGGAGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1143349624 17:6277790-6277812 CAGGGAAGCCTGTGAGCAGTTGG - Intergenic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144447684 17:15346077-15346099 CAGAGTGGCCACAGAGCAGGTGG + Intergenic
1144623254 17:16831667-16831689 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1144883177 17:18441049-18441071 CATGGTGGGCTGGGGGCAGAGGG + Intergenic
1145149053 17:20503337-20503359 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1147159582 17:38562430-38562452 GAGGGAGGGCAGAGAGCAGAAGG - Intronic
1147217203 17:38907876-38907898 CAGGACCGCCTGGGAGCAGATGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147559670 17:41501131-41501153 CAGGGGGTCCTGAGAGCAGAGGG + Exonic
1147577577 17:41611604-41611626 CATGGTGGGCTGGGGGCAGAGGG - Intronic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1147988961 17:44321870-44321892 CAGGGAGGCCTGAGGGCTGTGGG - Intronic
1148402756 17:47381636-47381658 CAGGTTTGCCAGAGATCAGATGG + Intronic
1148691317 17:49528491-49528513 AGGGGTGGCCTGAGGGAAGAGGG + Intergenic
1149308351 17:55370917-55370939 CCCTGTGGCCTAAGAGCAGAAGG + Intergenic
1150268772 17:63849184-63849206 CAGGGTTGGCTGAGATGAGAGGG - Intergenic
1150292217 17:63988469-63988491 CAGAGTGGCCTGAGTGGAGTTGG - Intergenic
1151412566 17:73941004-73941026 CAGGGTGGGATGAGAGGAAAGGG + Intergenic
1151483310 17:74383206-74383228 CAGGGAGGCCAGGGAGCAGCTGG + Intergenic
1151679454 17:75615849-75615871 CAGCGTGACCTGGGATCAGAGGG + Intergenic
1152082612 17:78197735-78197757 CAGAGTGGTCTCAGTGCAGATGG + Intronic
1152123253 17:78431712-78431734 GAGGGAGGCCTGAGGACAGAGGG + Intronic
1152200550 17:78943398-78943420 GAGGGTGGCGTGTGAGCAGGTGG - Intergenic
1152233314 17:79125659-79125681 CTGGAGGGCCTGAGAGGAGAGGG - Intronic
1152581393 17:81166858-81166880 CAGGTTGGCCTGGGCGCTGAGGG + Intergenic
1152669476 17:81593821-81593843 CAGGGTAGCTGGAGAGCAGCTGG - Intronic
1153523834 18:5977130-5977152 GAGGCTGGCCTGAGTGCAGAGGG - Intronic
1153784502 18:8522782-8522804 AAGGGTGGGCTCAGAGCAGCAGG - Intergenic
1154327924 18:13405510-13405532 GAGGATGGCCTGAGCTCAGAAGG - Intronic
1154476865 18:14768663-14768685 GACTGTGGCATGAGAGCAGAGGG + Intronic
1154955470 18:21250131-21250153 CTAGGAGGCCTGGGAGCAGATGG + Intronic
1155003098 18:21705001-21705023 AAGGGTGGGCCGAGAGCTGACGG + Intronic
1155112360 18:22728446-22728468 CAGGTTGGAATGAGAGTAGAAGG - Intergenic
1156508241 18:37612780-37612802 CAGGATGGCCTGAGCTGAGAAGG + Intergenic
1157826841 18:50819955-50819977 CAGGCTGGCATGAGGGAAGAAGG - Exonic
1158223856 18:55180250-55180272 CATGGTGGCCTCTGAGCAGTTGG - Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160428189 18:78792757-78792779 CAAGGTGGTGTGAGAGCAGCGGG + Intergenic
1160678688 19:403952-403974 CAGCCTGGGCTGAGAGCACAGGG + Intergenic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1161284106 19:3459961-3459983 CAGGGTGGACTGTGAGGGGAGGG - Intronic
1161406415 19:4093896-4093918 CAGGCTGGGCTGAGGGCAGGAGG + Intronic
1161723289 19:5915207-5915229 CAGTGTGACCTGGGAACAGAGGG - Exonic
1161768038 19:6217497-6217519 CAGGGTGGCCTGCCTGGAGAGGG + Intronic
1162109444 19:8392097-8392119 CACGGTGGGCTGAGTGGAGATGG - Intronic
1163306436 19:16482562-16482584 CAGGATGGCCTGAAACCAGAAGG - Exonic
1164840721 19:31390300-31390322 CAGGGTGGCCTATGGGGAGAGGG + Intergenic
1165061378 19:33206833-33206855 CAGGGTGACCTGAGGGCCCATGG + Intronic
1165460081 19:35939307-35939329 CACAGTGGGCTGAGGGCAGAAGG - Intronic
1165940126 19:39410664-39410686 CAAGGAGGCCTGAGAGCAGGAGG - Intergenic
1166140642 19:40803413-40803435 CAGGCTGGACTGAGAACATAGGG + Intronic
1167642972 19:50692152-50692174 CAGGGTGGATTCCGAGCAGATGG - Intronic
1167688022 19:50968728-50968750 CAGGGAGGCCTGGGAGCTGGGGG - Exonic
1168134042 19:54338592-54338614 CAGGGTGCCCTGACACCAGATGG + Exonic
1168181159 19:54663820-54663842 CAGGGTCCCCTGACACCAGATGG - Exonic
1168185826 19:54698696-54698718 CAGGGAGGGCTGGGAGGAGACGG + Intronic
1202687739 1_KI270712v1_random:61254-61276 CACGGTGGCCTGGGAGGACAGGG + Intergenic
925161489 2:1687238-1687260 CAGGGTGCCCGGGGAGGAGAGGG - Intronic
925339617 2:3127085-3127107 CAGGGAAGCCTGAGAGCTGCTGG + Intergenic
925360608 2:3278007-3278029 GAGGGAGGCCTGGGAGCACAGGG - Intronic
925657581 2:6166117-6166139 CAGGGTGGCTTGAAAGCATCAGG - Intergenic
925701991 2:6647961-6647983 CATGGAGGGCTGTGAGCAGATGG + Intergenic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
926070514 2:9884840-9884862 CAGGTTGTCCTGAGAGCACAAGG - Intronic
926253313 2:11168702-11168724 CAGGGAGACCTGTGAGGAGAGGG - Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927645467 2:24874400-24874422 CTGGGTGGCCTGAGGACATATGG - Intronic
927779389 2:25927282-25927304 CCAGGTGGCCTGAGCGCAGGGGG - Exonic
928180603 2:29065727-29065749 CAGGCTGTCCTGCCAGCAGACGG - Intronic
928249864 2:29665998-29666020 CATGGTGGCAGGACAGCAGAAGG - Intronic
929171104 2:38934392-38934414 CAGGGTGGCTTGAATGCAGAGGG - Intronic
929490527 2:42392235-42392257 CAGCATGGACTAAGAGCAGACGG - Intronic
929689344 2:44061591-44061613 CAGGGTGGCCTCTGGGCAGAGGG + Intergenic
929875259 2:45791437-45791459 CAGGGTAGCCTGAAACTAGAAGG - Intronic
931184580 2:59937672-59937694 CAGGGTGGACTGATACCAGAGGG + Intergenic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931589942 2:63871780-63871802 CAGGATGGCCAGAGAAAAGAGGG - Intronic
931669908 2:64637811-64637833 CAGCCTGGCCTGTGAGCAGCAGG - Intronic
932579296 2:72983135-72983157 CAGGGTGGACTGAGCACAAAGGG + Intronic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
932892959 2:75611861-75611883 CAGGGCAGGCTGTGAGCAGAGGG - Intergenic
933870653 2:86562843-86562865 CAGGGAGGACGGAGAACAGACGG + Intronic
933958615 2:87394331-87394353 CACGGTGGCCTGGGAGGACAGGG - Intergenic
934242744 2:90286337-90286359 CACGGTGGCCTGGGAGGACAGGG - Intergenic
936022103 2:109002625-109002647 GAGGGTGGCCGGGGAGCAGAGGG - Intergenic
936074020 2:109390331-109390353 AGGGGTGTCCTGTGAGCAGAAGG - Intronic
937992947 2:127674435-127674457 ACGAGGGGCCTGAGAGCAGAGGG + Intronic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
938181624 2:129189844-129189866 TAGGGTGGCCTGAGTGTAGCAGG + Intergenic
938341120 2:130537391-130537413 GAGGGTGGCCCCAGAGCAGAGGG + Intergenic
938348710 2:130583318-130583340 GAGGGTGGCCCCAGAGCAGAGGG - Intronic
939177569 2:138767252-138767274 CAGTGTGGCCTGACCACAGAAGG + Intronic
939271618 2:139946901-139946923 TAGGGAGGGCTGACAGCAGAGGG - Intergenic
940495408 2:154422005-154422027 CAGCGTGCACAGAGAGCAGAGGG + Intronic
941501637 2:166285769-166285791 CAGGGAGGCCTGAGAGATGAAGG + Intronic
941693510 2:168526760-168526782 GCGAGTGGCCTGACAGCAGAAGG + Intronic
942227183 2:173827462-173827484 CAGGGTGGCTTGACAGAAGGAGG + Intergenic
942282354 2:174378053-174378075 CTTGGTGGCCTGAGAGGACAGGG + Intronic
943166212 2:184329191-184329213 CAGGGAGCTCTGAGAGCACAAGG + Intergenic
943189128 2:184653674-184653696 CATGGTGGCCTGTGAGCACTTGG + Intronic
944416660 2:199486059-199486081 AAGGGTGGCCTCAAAGCAGGGGG - Intergenic
946043741 2:216803968-216803990 CATGCTGCCCTGAGAGCAGCGGG - Intergenic
946321130 2:218955189-218955211 CAGCGGGGCCTGGGAGGAGAAGG + Intergenic
947501731 2:230675797-230675819 CTGGCTGTCCTCAGAGCAGAAGG - Intergenic
947748341 2:232520703-232520725 CAGGCTGGCCCGAGAGCCGCGGG + Intronic
948439146 2:237975189-237975211 CAGGATCGCCTGAGCCCAGAAGG - Intronic
948844364 2:240676156-240676178 CACGGAGGCCTGAGACCCGATGG - Intergenic
948849494 2:240698723-240698745 CACGGAGGCCTGAGACCCGATGG + Intergenic
1170512984 20:17098077-17098099 CAGCTTGTCCTGAGAGCAGGAGG + Intergenic
1170989492 20:21288721-21288743 CAGGATGGCCTGAGCCCAGGAGG + Intergenic
1172330489 20:34072685-34072707 CAGGAGGGCCTGAGAGCACAAGG + Intronic
1173328146 20:42052230-42052252 CAGAGTGCCCTCAGAGCACAAGG - Intergenic
1174303761 20:49600699-49600721 CAGGAAGCTCTGAGAGCAGAGGG - Intergenic
1174305050 20:49609139-49609161 CAGGGACCCCTGAGAGCAGAGGG - Intergenic
1175256590 20:57651326-57651348 CAGAGTCGCCTGACGGCAGAGGG - Exonic
1175286121 20:57837996-57838018 CAGAGCAGCCTGAGTGCAGAGGG - Intergenic
1175295870 20:57908364-57908386 CAGAGAGGCCTGAGGGCAGCAGG + Intergenic
1175334532 20:58186451-58186473 GAGGGTGGCTGGACAGCAGATGG + Intergenic
1175570242 20:60012615-60012637 CAAGCTGGCCAGAGAGCTGAGGG - Exonic
1175786534 20:61715670-61715692 CTGGGTGGTCTCAGACCAGAGGG - Intronic
1175909312 20:62397059-62397081 GAAGGTGGCCTGAGAGCAAGGGG - Intronic
1175927525 20:62478164-62478186 CAGAGTGCCGGGAGAGCAGAAGG - Intergenic
1175985614 20:62762929-62762951 GTGGGTGGGCTGTGAGCAGAGGG - Intergenic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176296207 21:5074879-5074901 CTGGGTGGCCTGAGGGCAACTGG + Intergenic
1176382713 21:6121179-6121201 CTGGGGGGCCTGGGAGCAGCCGG - Exonic
1176446466 21:6826265-6826287 GAGGGTGGCTTGAGACCAGGAGG + Intergenic
1176824636 21:13691295-13691317 GAGGGTGGCTTGAGACCAGGAGG + Intergenic
1178327243 21:31655841-31655863 GTGGGTGGACTGAGAGCAGATGG - Intergenic
1178497828 21:33101879-33101901 CAGGGCGGCCTGAAAGGAGCGGG + Intergenic
1178541205 21:33452285-33452307 CATGGTGGTCTGAGAGTGGAGGG + Intronic
1178596844 21:33962088-33962110 CAGGAGGGAGTGAGAGCAGAAGG + Intergenic
1178733918 21:35131667-35131689 CAGGCTTCCCTGAGAGCAGATGG + Intronic
1179605438 21:42513106-42513128 CAGGATGGCTTCAGAGCAGAGGG - Intronic
1179740756 21:43417060-43417082 CTGGGGGGCCTGGGAGCAGCCGG + Exonic
1179860842 21:44187242-44187264 CTGGGTGGCCTGAGGGCAACTGG - Intergenic
1179925264 21:44530720-44530742 CCAGCTGGCCTGAGAGCAGCAGG + Intronic
1180079825 21:45481564-45481586 CAGAGAGGCCTCAGAGCCGATGG - Intronic
1181321448 22:22010029-22010051 CACTGTGTCCTGAGAGCACAGGG + Intergenic
1181803418 22:25361418-25361440 CAGCGTGGCCTGACAGCGTACGG + Exonic
1182160173 22:28113552-28113574 CAGCTTGTCCTGAAAGCAGATGG - Intronic
1182426943 22:30278572-30278594 CAGGGAGGCCTGAGGGCATGTGG + Intergenic
1182832191 22:33313267-33313289 CTGAGTGGACTGAGAGTAGAAGG - Intronic
1183043753 22:35203311-35203333 CAGGCTGGCATTACAGCAGAAGG - Intergenic
1183280517 22:36929658-36929680 CAGGGTGGCCTGGGAGGTGTTGG - Exonic
1183428672 22:37752746-37752768 CAGGGTCCCCGGAGGGCAGAGGG + Intronic
1183443104 22:37834606-37834628 CAGGGCGGCTTGAGCCCAGAAGG + Intronic
1183906958 22:41048959-41048981 CCTGGTGGCCTGAGAGCTGCGGG + Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184248157 22:43246011-43246033 CAGGGAGGCCTGAGGGCTGGTGG + Intronic
1184399399 22:44265042-44265064 ATGGGGGGACTGAGAGCAGAAGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184689425 22:46110706-46110728 CAGGGTGGGGTGAGGGCTGAAGG - Intronic
1184761784 22:46549053-46549075 CAGGGTGTTCTGGGAGGAGAAGG + Intergenic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1184841774 22:47056365-47056387 CAGGGCTGCCTGTGAGCTGACGG + Intronic
1185312355 22:50163093-50163115 CAGGGTGGCAGGAGACCAGGCGG + Intergenic
1185408444 22:50670938-50670960 GGGGATGGCCTGGGAGCAGAGGG + Intergenic
950129814 3:10534284-10534306 CAGGCTGGTCTGAATGCAGAAGG - Intronic
950172702 3:10850680-10850702 GATGGTGGCATGAGATCAGAAGG + Intronic
950534068 3:13569365-13569387 CAGTCTGGCCTGAGAGCAGCTGG - Intronic
950665935 3:14494981-14495003 CAGGGTCACCTGGAAGCAGAAGG + Exonic
953129885 3:40127727-40127749 CAGGGAGGTAGGAGAGCAGAAGG + Intronic
953532271 3:43749370-43749392 GAGGGTAGGCTGGGAGCAGAGGG - Intergenic
954462961 3:50638181-50638203 CTGGGAGGCCTGACAGGAGATGG + Intronic
956065754 3:65395715-65395737 GAGGGTGGCCTGAGAGGAACTGG + Intronic
956167169 3:66405640-66405662 CTGGTTGGTATGAGAGCAGACGG - Intronic
956518351 3:70076215-70076237 GAGGGTGGCGTGGGAGAAGAAGG + Intergenic
958987461 3:100798968-100798990 GAGGGTGGCCCAAGAGCACAGGG - Intronic
959100756 3:102007341-102007363 CAGTGTGGACTGAAAGCTGAGGG - Intergenic
959242814 3:103820348-103820370 CAGGGTTGCCTGTGAGCATTTGG + Intergenic
960228290 3:115193143-115193165 CATGGTGGGTTGAGAGCAGAAGG - Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961667924 3:128505148-128505170 CATGGTGGCCTCAGGGCAGTTGG - Intergenic
961886410 3:130099339-130099361 CAGGCTGGGCTGGGATCAGATGG - Intronic
963485188 3:145927009-145927031 AAGGGAGACCTGAGAGTAGATGG + Intergenic
964116283 3:153139526-153139548 CAGGGTGGACTGAGGACTGAAGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964823936 3:160805027-160805049 CAGGGCAGCCTGACAGCAGGAGG - Intronic
965925535 3:173974939-173974961 CAGGGTGGCATGTGAGAAAAGGG - Intronic
967052398 3:185796987-185797009 CTGGGAGGCCTGAGAGTGGATGG - Intronic
967200536 3:187068897-187068919 CAGGGAGGCCTGAGGACAGAGGG - Intronic
967220760 3:187246067-187246089 CAGAGAGGCCTGGGAGCAGGAGG - Intronic
968065606 3:195757407-195757429 GAGGGTGGCCTGAGAGGGGTGGG - Intronic
968432919 4:569211-569233 CGGGGTGCGCTGAGAGCAGGGGG - Intergenic
968484168 4:850720-850742 CAGGGTGGCCTGAGGCCAGGGGG - Intronic
968741100 4:2332194-2332216 CAGGGAACACTGAGAGCAGAGGG - Intronic
968948317 4:3677124-3677146 CAGGCCGGGCTGAGAGCAGCGGG + Intergenic
969099389 4:4757440-4757462 CAGGGGGACCTGAGAGCACAGGG - Intergenic
969213052 4:5702240-5702262 CAGAGTGGTCTGAGAGATGAGGG - Intronic
969241499 4:5901666-5901688 CAGGGTGTCCTGTGTGCAGTGGG + Intronic
969264548 4:6056125-6056147 CAGGGTGTCCTTAGAGAACAAGG + Intronic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969691260 4:8705400-8705422 CAGGGTGGCCTGGGGAGAGAGGG + Intergenic
969708705 4:8830592-8830614 CAGGCTGGCCCCAGAGCAGCAGG + Intergenic
969758402 4:9165352-9165374 CAGGCTGGACTGGGATCAGATGG + Intergenic
971376437 4:26059516-26059538 CAGGCAGGCCTGAGACAAGATGG + Intergenic
971986227 4:33828734-33828756 CATGGTGGCCTCATGGCAGAGGG + Intergenic
972694667 4:41433901-41433923 GAGGGAGGACTGAGGGCAGAGGG + Intronic
972938483 4:44168065-44168087 CAGGGTGGCGGCAGGGCAGAGGG - Intergenic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
975065182 4:70052885-70052907 GAGGATGGCTTGAGACCAGATGG + Intronic
979093362 4:116516099-116516121 AAGGCTGCCCTGAGAGCTGAAGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
981390093 4:144179452-144179474 CAATGGGGCCTGAGAGGAGAGGG + Intergenic
981552381 4:145955159-145955181 CAGGGAGGCTTGAGAGCATTCGG - Intergenic
982166456 4:152617875-152617897 CAGTGTGGCCTGAGAGTGCAAGG - Intergenic
982233402 4:153230027-153230049 CAGGCTAACCTGAGAGAAGAAGG + Intronic
984442068 4:179784446-179784468 CATTTTGGTCTGAGAGCAGATGG + Intergenic
984977539 4:185242751-185242773 CAGGGGCCCCTGAGAGTAGAAGG + Intronic
985933577 5:3078207-3078229 CAGGGTGGGCTTAGAGAAAAAGG + Intergenic
986242817 5:5976641-5976663 CAGGGTGATCTCAGAGGAGAAGG + Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
987034167 5:14003800-14003822 CAGGGTGGCCTCAGGGCAGTGGG - Intergenic
988616419 5:32779469-32779491 CGGGGTGGCCAGAGAACGGAGGG - Intronic
989362790 5:40622860-40622882 CAGGGTTGTGAGAGAGCAGAGGG - Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
990749598 5:59000126-59000148 CAGGGTGGCCTCAGAGCTGCAGG - Intronic
992477396 5:77117163-77117185 GAGGTTGGAATGAGAGCAGAGGG + Intergenic
992879956 5:81097959-81097981 GAGGATGGGCTGAGGGCAGAGGG + Intronic
994920468 5:106036254-106036276 CAGGGTTGCCTCAGAGCAAGAGG - Intergenic
994977953 5:106835401-106835423 CAGGATGGCTTGAGACCAGGAGG - Intergenic
997381771 5:133443637-133443659 CAGGCTGGCCTGAGAGGAGCTGG - Intronic
997469106 5:134106940-134106962 CAGGGAGGACAGAGACCAGAGGG - Intergenic
997781784 5:136667053-136667075 CAGGATGGGCTGAGAGCCGAGGG + Intergenic
998104289 5:139458402-139458424 CAGGATTGCTTGAGACCAGAAGG + Intronic
998641059 5:144011799-144011821 CTGGGTGGACTCAGAGCAGATGG + Intergenic
998712297 5:144841021-144841043 CAGGCTGCCCTGAGAAGAGAGGG + Intergenic
999246537 5:150157998-150158020 CAGGCTGGCCTGGCTGCAGAGGG - Intergenic
999628486 5:153545073-153545095 CAGGGTCTCCTCAGAGCACATGG - Intronic
1000287998 5:159844480-159844502 CAGGGCAGCCTGACAGCAGGAGG - Intergenic
1002094398 5:176822651-176822673 CAGGTTGGCCTGAGGCCAGCAGG - Intronic
1002166074 5:177347241-177347263 GAGGCTGACCTCAGAGCAGAAGG + Intronic
1002197296 5:177508439-177508461 GATGGTGGCCTGGGAGCAGCGGG - Exonic
1002433494 5:179217858-179217880 GGGGATGGCCTGAGGGCAGACGG + Intronic
1002433503 5:179217896-179217918 GGGGATGGCCTGAGGGCAGACGG + Intronic
1002925691 6:1604719-1604741 AGGGGCGGCCTGGGAGCAGACGG + Intergenic
1003896070 6:10608945-10608967 CAGGGTGGCCAGAGAGCTCCTGG + Intronic
1006175891 6:32121287-32121309 CAGGGAGGCCTCAGAGTTGACGG + Exonic
1006257546 6:32843773-32843795 GAGGGTCGCCTGAGAGGAGGAGG - Intronic
1006335349 6:33417687-33417709 CAGAGAGGCCTGAGAGCAGGAGG + Exonic
1006453219 6:34117402-34117424 CAGGGGGGCCTGGGAGAAGGAGG - Intronic
1006780934 6:36631807-36631829 CAGGGAGGCATGTGAGCAGCTGG + Intergenic
1006982656 6:38158336-38158358 GGGGGTGGGATGAGAGCAGACGG + Intergenic
1007287468 6:40758028-40758050 CAGGGAGGGCTGAATGCAGAGGG + Intergenic
1007707323 6:43798846-43798868 CTGGGTCCCCTGTGAGCAGATGG + Intergenic
1007843901 6:44738488-44738510 CCAGGAGGGCTGAGAGCAGAGGG + Intergenic
1008564057 6:52749995-52750017 CAAGGTGGCCTGAGAGCAGAGGG + Intergenic
1008565571 6:52764711-52764733 CAAGTTGGCCTGAGAGCAGAGGG + Intergenic
1008568370 6:52791276-52791298 TAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008569756 6:52805049-52805071 CAAGTTGGCCTGAGAGCAGAGGG + Intergenic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1009284434 6:61798021-61798043 CAGGCTGACTTGAGAGGAGAAGG - Intronic
1009592645 6:65691865-65691887 CAGGTTTGCCTAAGATCAGATGG + Intronic
1010189165 6:73176754-73176776 CAGGCTGGCTTGAGGGGAGATGG + Intronic
1010924760 6:81731466-81731488 CAGGTAGGCCTGAGAGCAAGGGG - Intronic
1011095009 6:83651584-83651606 CATTGTGGTCTGAGAGCAGATGG + Intronic
1011293675 6:85804858-85804880 AGCTGTGGCCTGAGAGCAGATGG - Intergenic
1012352175 6:98265941-98265963 GAGGGTGGCTTGGGAGCAGCTGG + Intergenic
1012367776 6:98463560-98463582 CAGGTTCAGCTGAGAGCAGAAGG - Intergenic
1012475793 6:99613802-99613824 CCGGGGGGACGGAGAGCAGAGGG - Exonic
1013270093 6:108537393-108537415 CAGGGTGCCCTGGGATCAGAAGG + Intergenic
1014778002 6:125533014-125533036 CTGGATGACCTGAAAGCAGATGG - Intergenic
1016869701 6:148804418-148804440 AAGGGTGGCCTTACAGCAGGTGG - Intronic
1017602562 6:156099756-156099778 CAGGGTGGCAGGAGAGAAAAGGG - Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019313720 7:375110-375132 GAGGCAGGCCTGAGGGCAGAAGG - Intergenic
1019404877 7:877833-877855 CAGGGAGGCCTGAGAGAGAAAGG - Intronic
1019466769 7:1193965-1193987 CAGGGTGTCCTGAGAGAGGTAGG - Intergenic
1020007793 7:4791577-4791599 CAGTGTTGCCTGGGAGCAAAAGG - Exonic
1020636401 7:10700722-10700744 CAGGTTGGCCAAAGATCAGATGG - Intergenic
1020888716 7:13852189-13852211 CTGGATGGCTTGAAAGCAGATGG - Intergenic
1021625395 7:22588243-22588265 CAGACTGGCCTGAGTGCAGAAGG + Intronic
1021974859 7:26002007-26002029 GAGGGTGGGCTGAGACCAGGTGG - Intergenic
1022414458 7:30166212-30166234 CATGGTTGCCTGGGAACAGATGG + Intergenic
1022970709 7:35514239-35514261 CAGGGAGACCTGGAAGCAGAAGG - Intergenic
1023025597 7:36047161-36047183 CAGGCTTCCCTGAGAGCAGTAGG - Intergenic
1023632248 7:42176407-42176429 CTGGGTGGCGTTAGAGAAGAAGG - Intronic
1024059956 7:45690243-45690265 CAGCCTGGGCTGAGAGCGGAGGG + Intronic
1025901855 7:65751174-65751196 CAAGGTGGCCGGAGCGCAGGCGG + Intergenic
1026815132 7:73505047-73505069 CAGGCTGGCAAGAGAGAAGAGGG - Intronic
1027226015 7:76244076-76244098 CAGGGTGGCCTGAGCCACGAGGG + Intronic
1029492838 7:100881740-100881762 CAGGGTGGCCCCAGGGCTGAGGG - Exonic
1029889650 7:103914026-103914048 CAGGGTTGCCTGTGAGAGGAAGG + Intronic
1030086945 7:105824093-105824115 GAGGGTGCTCTAAGAGCAGATGG - Intronic
1030359355 7:108579361-108579383 CAGGTGTGCCTGGGAGCAGAGGG - Intergenic
1030873169 7:114782322-114782344 CATGCTGCCCTGAGAGCAGGAGG - Intergenic
1031091682 7:117364478-117364500 GAGGGAGGGCTGAGAGGAGAGGG + Intronic
1031158525 7:118138853-118138875 GAGGATGGCCTGAGCCCAGAAGG - Intergenic
1031897223 7:127364505-127364527 CAGGGTAGTATGAGAGCACATGG + Intronic
1033434756 7:141322776-141322798 GAGGGTGGAATGAGAGCAGGTGG + Intronic
1033658750 7:143389877-143389899 CATGATGGGCTCAGAGCAGACGG - Exonic
1033951315 7:146788193-146788215 CCGTGTGGCCTGAGAGCAGAGGG + Intronic
1034165264 7:149020602-149020624 CAGGGTGGCCTGAGACAGGTCGG + Intronic
1034401515 7:150864596-150864618 CAGGGAGAACTGAGAGCAGCAGG + Intergenic
1034463031 7:151209047-151209069 CGGGGTGTGCTGACAGCAGAGGG - Intronic
1034895251 7:154872289-154872311 TATGGTGCCCTGAGAGCAGGAGG - Intronic
1035179843 7:157081386-157081408 CTGGTTGGCCTTAGAGCTGAAGG - Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035599777 8:890801-890823 CAGGGTGGCTTGGGCACAGAGGG - Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036771695 8:11582943-11582965 GAGGGAGCTCTGAGAGCAGATGG + Intergenic
1037693857 8:21207055-21207077 CAGGGTGGTCTGACTCCAGAGGG - Intergenic
1038021610 8:23555846-23555868 CAGGGTGACCTGAACGCTGAAGG + Intronic
1038158702 8:25015963-25015985 CAAGGTGTCCTGAGAACTGAGGG + Intergenic
1038600958 8:28942003-28942025 TGGGGTGGCCTGAGGGCGGATGG - Intronic
1039308888 8:36294363-36294385 CAAGCTGTCCAGAGAGCAGAGGG + Intergenic
1039916632 8:41865099-41865121 CAGGGAGGCCTCAGCTCAGAGGG - Intronic
1040944946 8:52874378-52874400 AAGGGTGGCCTCAGAGAAGGAGG - Intergenic
1041153503 8:54960523-54960545 CAGGGGTGCCTGAGGCCAGAGGG - Intergenic
1041223826 8:55678237-55678259 CAGGGTGGCCTGATACTACAAGG - Intergenic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1042134085 8:65617088-65617110 CAGGGTGGCCGCCGGGCAGAGGG - Intronic
1042149679 8:65768145-65768167 CATGGTGGTGTGAGAGCAGAGGG + Intronic
1044637586 8:94342041-94342063 CTGGGTGGCCTGGGGGCAGGGGG - Intergenic
1046195709 8:110860502-110860524 CAGGATGGCCTGAAACCTGAAGG + Intergenic
1047211252 8:122842266-122842288 CTGGGGGCCCTGAGAGAAGAAGG - Intronic
1047775305 8:128065538-128065560 CAGACTGGCCTGAGAACATAGGG - Intergenic
1047911413 8:129534301-129534323 CAGACTGGCCTCAGATCAGAGGG - Intergenic
1047928402 8:129702911-129702933 CAGGGAGTTCTGAGGGCAGAGGG - Intergenic
1048331956 8:133476700-133476722 CAGGTTGGCATGACACCAGAAGG - Intronic
1048987575 8:139743018-139743040 CAGAGTGGGCTGAGAGGAGCAGG + Intronic
1049515174 8:143050647-143050669 CAGGCTGGCATGAGAGAAGCTGG - Intronic
1049599188 8:143499157-143499179 GAGGGAAGCCTGGGAGCAGAGGG + Intronic
1049623073 8:143607304-143607326 CAGGATGGCCTGTGAGGAGTAGG - Intronic
1049657385 8:143804846-143804868 CAGGGAGGCCCAAGGGCAGAAGG + Intronic
1049713312 8:144077348-144077370 CAGAGTGGCTGTAGAGCAGAGGG + Intergenic
1049759146 8:144324055-144324077 CTGGGGTGCCTGTGAGCAGAGGG + Intronic
1049761742 8:144334743-144334765 GTGGGTGGCCGGAGAGCTGAGGG - Intronic
1049765465 8:144353357-144353379 CAGGCTGGACTGAGAGGAGCTGG + Exonic
1051233871 9:14978588-14978610 CAGGCTGGCCTGAGAGTTAAGGG - Intergenic
1056812895 9:89777934-89777956 CAGCTTTGCCAGAGAGCAGAAGG + Intergenic
1057569513 9:96193838-96193860 CAGGGTGGTGTCAGAGCAGGTGG + Intergenic
1057951303 9:99370869-99370891 CAGAGGGGCCTGAAAACAGATGG - Intergenic
1058975979 9:110126074-110126096 CAGGGTGGCCTGGGGGAATATGG + Intronic
1059176912 9:112175817-112175839 CCGGGTGTCCTCAGAGCAGCGGG - Intergenic
1059285708 9:113169747-113169769 CATGGTGCCCTCAGAGCAGGTGG - Exonic
1059537366 9:115093911-115093933 CATGGTGGTCTGAGGGCAGTGGG + Intronic
1060207759 9:121692667-121692689 TAGGGTGGCCTGTGAGTAGGTGG + Intronic
1060725925 9:126005917-126005939 CCGAGTGGCCTGAGAGCCCAGGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061798354 9:133101338-133101360 AAGGCTGGCCTGAGGGCAGAGGG - Intronic
1061812115 9:133168163-133168185 CAGGCTCCCCTGAGAGCAGAAGG + Intergenic
1061919955 9:133777336-133777358 CACGGTGGCCTGGGTGCTGAGGG - Intronic
1062232479 9:135489562-135489584 TGCGGTGGCCTCAGAGCAGAAGG - Intergenic
1062598737 9:137310801-137310823 CAGGGTGCTCTGACATCAGAAGG - Intronic
1062607810 9:137355852-137355874 CAGGGGGTCCTGGGAGCAAAGGG + Intronic
1062715992 9:138010328-138010350 CAGGGTGTGCTGGGAGCAGGAGG + Intronic
1203522724 Un_GL000213v1:58266-58288 GAGGGTGGCTTGAGACCAGGAGG - Intergenic
1185534111 X:846066-846088 CACGGTGGCCTGGGAGGACAGGG - Intergenic
1186402189 X:9270264-9270286 CAGGGTGGCCCCAGAGGACAGGG - Intergenic
1186459918 X:9739929-9739951 CAAGGGTGCCTGAAAGCAGAGGG + Intronic
1190700693 X:52987396-52987418 CAGGATGGCTTGAGCCCAGAAGG + Intronic
1195068531 X:101258572-101258594 CAGGGTGGCCTCTGAGCCCAGGG + Intronic
1195897854 X:109766274-109766296 CATTGTGGTCTGAGAGCACACGG - Intergenic
1196520756 X:116668156-116668178 CAGGGTGGACTCAGAGGAGCAGG - Intergenic
1197114056 X:122811044-122811066 CAGAGAGGCCTGAGAACACACGG - Intergenic
1197769087 X:130078375-130078397 TTGGGAGGCGTGAGAGCAGAAGG + Intronic
1199661391 X:150053959-150053981 CAGGGAGCTCTGAGAGTAGAGGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200226417 X:154420150-154420172 CAGGGCAGCCTGGGACCAGAGGG - Intronic
1202124691 Y:21557479-21557501 GGGGGTGCCCTGAGAGCACATGG - Intergenic
1202154317 Y:21871901-21871923 GGGGGTGCCCTGAGAGCACATGG + Intergenic