ID: 1008583635

View in Genome Browser
Species Human (GRCh38)
Location 6:52929305-52929327
Sequence ATGTGAACAGCACTTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008583635_1008583638 1 Left 1008583635 6:52929305-52929327 CCAGGAAGAAGTGCTGTTCACAT No data
Right 1008583638 6:52929329-52929351 CAGTTCTCTGGAGCCACTAATGG No data
1008583635_1008583641 8 Left 1008583635 6:52929305-52929327 CCAGGAAGAAGTGCTGTTCACAT No data
Right 1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG No data
1008583635_1008583640 7 Left 1008583635 6:52929305-52929327 CCAGGAAGAAGTGCTGTTCACAT No data
Right 1008583640 6:52929335-52929357 TCTGGAGCCACTAATGGAGAGGG No data
1008583635_1008583642 13 Left 1008583635 6:52929305-52929327 CCAGGAAGAAGTGCTGTTCACAT No data
Right 1008583642 6:52929341-52929363 GCCACTAATGGAGAGGGGTATGG No data
1008583635_1008583639 6 Left 1008583635 6:52929305-52929327 CCAGGAAGAAGTGCTGTTCACAT No data
Right 1008583639 6:52929334-52929356 CTCTGGAGCCACTAATGGAGAGG No data
1008583635_1008583644 14 Left 1008583635 6:52929305-52929327 CCAGGAAGAAGTGCTGTTCACAT No data
Right 1008583644 6:52929342-52929364 CCACTAATGGAGAGGGGTATGGG No data
1008583635_1008583645 21 Left 1008583635 6:52929305-52929327 CCAGGAAGAAGTGCTGTTCACAT No data
Right 1008583645 6:52929349-52929371 TGGAGAGGGGTATGGGCCCAAGG No data
1008583635_1008583646 30 Left 1008583635 6:52929305-52929327 CCAGGAAGAAGTGCTGTTCACAT No data
Right 1008583646 6:52929358-52929380 GTATGGGCCCAAGGATAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008583635 Original CRISPR ATGTGAACAGCACTTCTTCC TGG (reversed) Intergenic
No off target data available for this crispr