ID: 1008583641

View in Genome Browser
Species Human (GRCh38)
Location 6:52929336-52929358
Sequence CTGGAGCCACTAATGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008583635_1008583641 8 Left 1008583635 6:52929305-52929327 CCAGGAAGAAGTGCTGTTCACAT No data
Right 1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008583641 Original CRISPR CTGGAGCCACTAATGGAGAG GGG Intergenic
No off target data available for this crispr