ID: 1008584565

View in Genome Browser
Species Human (GRCh38)
Location 6:52937048-52937070
Sequence AGTAACCAAGTGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008584565_1008584577 22 Left 1008584565 6:52937048-52937070 CCTGCCTCCTCCACTTGGTTACT No data
Right 1008584577 6:52937093-52937115 TGGCAGCAGCAGGGGCACCAAGG No data
1008584565_1008584572 12 Left 1008584565 6:52937048-52937070 CCTGCCTCCTCCACTTGGTTACT No data
Right 1008584572 6:52937083-52937105 AGGACCTCCATGGCAGCAGCAGG No data
1008584565_1008584573 13 Left 1008584565 6:52937048-52937070 CCTGCCTCCTCCACTTGGTTACT No data
Right 1008584573 6:52937084-52937106 GGACCTCCATGGCAGCAGCAGGG No data
1008584565_1008584570 -8 Left 1008584565 6:52937048-52937070 CCTGCCTCCTCCACTTGGTTACT No data
Right 1008584570 6:52937063-52937085 TGGTTACTTTTGGCTGCATCAGG No data
1008584565_1008584571 2 Left 1008584565 6:52937048-52937070 CCTGCCTCCTCCACTTGGTTACT No data
Right 1008584571 6:52937073-52937095 TGGCTGCATCAGGACCTCCATGG No data
1008584565_1008584578 28 Left 1008584565 6:52937048-52937070 CCTGCCTCCTCCACTTGGTTACT No data
Right 1008584578 6:52937099-52937121 CAGCAGGGGCACCAAGGAAGAGG No data
1008584565_1008584574 14 Left 1008584565 6:52937048-52937070 CCTGCCTCCTCCACTTGGTTACT No data
Right 1008584574 6:52937085-52937107 GACCTCCATGGCAGCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008584565 Original CRISPR AGTAACCAAGTGGAGGAGGC AGG (reversed) Intergenic