ID: 1008584571

View in Genome Browser
Species Human (GRCh38)
Location 6:52937073-52937095
Sequence TGGCTGCATCAGGACCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008584561_1008584571 25 Left 1008584561 6:52937025-52937047 CCCCACTCTTTTGAGGAACTTCT No data
Right 1008584571 6:52937073-52937095 TGGCTGCATCAGGACCTCCATGG No data
1008584566_1008584571 -2 Left 1008584566 6:52937052-52937074 CCTCCTCCACTTGGTTACTTTTG No data
Right 1008584571 6:52937073-52937095 TGGCTGCATCAGGACCTCCATGG No data
1008584565_1008584571 2 Left 1008584565 6:52937048-52937070 CCTGCCTCCTCCACTTGGTTACT No data
Right 1008584571 6:52937073-52937095 TGGCTGCATCAGGACCTCCATGG No data
1008584562_1008584571 24 Left 1008584562 6:52937026-52937048 CCCACTCTTTTGAGGAACTTCTC No data
Right 1008584571 6:52937073-52937095 TGGCTGCATCAGGACCTCCATGG No data
1008584569_1008584571 -8 Left 1008584569 6:52937058-52937080 CCACTTGGTTACTTTTGGCTGCA No data
Right 1008584571 6:52937073-52937095 TGGCTGCATCAGGACCTCCATGG No data
1008584560_1008584571 29 Left 1008584560 6:52937021-52937043 CCAGCCCCACTCTTTTGAGGAAC No data
Right 1008584571 6:52937073-52937095 TGGCTGCATCAGGACCTCCATGG No data
1008584568_1008584571 -5 Left 1008584568 6:52937055-52937077 CCTCCACTTGGTTACTTTTGGCT No data
Right 1008584571 6:52937073-52937095 TGGCTGCATCAGGACCTCCATGG No data
1008584563_1008584571 23 Left 1008584563 6:52937027-52937049 CCACTCTTTTGAGGAACTTCTCC No data
Right 1008584571 6:52937073-52937095 TGGCTGCATCAGGACCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008584571 Original CRISPR TGGCTGCATCAGGACCTCCA TGG Intergenic
No off target data available for this crispr