ID: 1008584578

View in Genome Browser
Species Human (GRCh38)
Location 6:52937099-52937121
Sequence CAGCAGGGGCACCAAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008584565_1008584578 28 Left 1008584565 6:52937048-52937070 CCTGCCTCCTCCACTTGGTTACT No data
Right 1008584578 6:52937099-52937121 CAGCAGGGGCACCAAGGAAGAGG No data
1008584569_1008584578 18 Left 1008584569 6:52937058-52937080 CCACTTGGTTACTTTTGGCTGCA No data
Right 1008584578 6:52937099-52937121 CAGCAGGGGCACCAAGGAAGAGG No data
1008584568_1008584578 21 Left 1008584568 6:52937055-52937077 CCTCCACTTGGTTACTTTTGGCT No data
Right 1008584578 6:52937099-52937121 CAGCAGGGGCACCAAGGAAGAGG No data
1008584566_1008584578 24 Left 1008584566 6:52937052-52937074 CCTCCTCCACTTGGTTACTTTTG No data
Right 1008584578 6:52937099-52937121 CAGCAGGGGCACCAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008584578 Original CRISPR CAGCAGGGGCACCAAGGAAG AGG Intergenic
No off target data available for this crispr