ID: 1008586355

View in Genome Browser
Species Human (GRCh38)
Location 6:52954001-52954023
Sequence CCTGTAATTCTGAAGGTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008586355_1008586364 30 Left 1008586355 6:52954001-52954023 CCATATACCTTCAGAATTACAGG No data
Right 1008586364 6:52954054-52954076 AGATATGGGAAAGTTGGCATGGG No data
1008586355_1008586361 16 Left 1008586355 6:52954001-52954023 CCATATACCTTCAGAATTACAGG No data
Right 1008586361 6:52954040-52954062 TGTTTTAAAGATGAAGATATGGG No data
1008586355_1008586363 29 Left 1008586355 6:52954001-52954023 CCATATACCTTCAGAATTACAGG No data
Right 1008586363 6:52954053-52954075 AAGATATGGGAAAGTTGGCATGG No data
1008586355_1008586362 24 Left 1008586355 6:52954001-52954023 CCATATACCTTCAGAATTACAGG No data
Right 1008586362 6:52954048-52954070 AGATGAAGATATGGGAAAGTTGG No data
1008586355_1008586360 15 Left 1008586355 6:52954001-52954023 CCATATACCTTCAGAATTACAGG No data
Right 1008586360 6:52954039-52954061 CTGTTTTAAAGATGAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008586355 Original CRISPR CCTGTAATTCTGAAGGTATA TGG (reversed) Intergenic
No off target data available for this crispr