ID: 1008589381

View in Genome Browser
Species Human (GRCh38)
Location 6:52977799-52977821
Sequence AACCGAATCCTGCTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008589381_1008589386 -9 Left 1008589381 6:52977799-52977821 CCTGTGAGAAGCAGGATTCGGTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1008589386 6:52977813-52977835 GATTCGGTTGCGGGGAAGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1008589381_1008589385 -10 Left 1008589381 6:52977799-52977821 CCTGTGAGAAGCAGGATTCGGTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1008589385 6:52977812-52977834 GGATTCGGTTGCGGGGAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008589381 Original CRISPR AACCGAATCCTGCTTCTCAC AGG (reversed) Intergenic
902929109 1:19717798-19717820 AACCAAATGCTGCATCTCAAGGG - Intronic
906988775 1:50714737-50714759 AATCAAATCCTTCTCCTCACTGG + Intronic
914094932 1:144537096-144537118 AACAGAATCCTGCACCTAACAGG - Intergenic
914303591 1:146396802-146396824 AACAGAATCCTGCACCTAACAGG + Intergenic
914516150 1:148376384-148376406 AACAGAATCCTGCACCTAACAGG - Intergenic
918492794 1:185099910-185099932 AATGGTATACTGCTTCTCACTGG - Exonic
921859172 1:220023068-220023090 AAGAGTATCCTGCTTCTCATTGG - Intronic
1065374756 10:25027459-25027481 AACCGCAACCTGCATCTCCCAGG - Intronic
1065599023 10:27349786-27349808 AACGTAATGCTGATTCTCACTGG + Intergenic
1068419890 10:56777874-56777896 AATCAAATCCTGCTTCTACCAGG - Intergenic
1069691480 10:70355903-70355925 ACACGAATCCTGCATCTCAGAGG + Intronic
1070160170 10:73861962-73861984 ACACAAATCCTGCTTCTCCCCGG + Intronic
1075998816 10:126899119-126899141 AACTGAACCCTGAGTCTCACTGG - Intergenic
1082074088 11:47962813-47962835 AACCAAATCCTAATTCTCAAAGG - Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1092764590 12:11841307-11841329 AACGCAATCCTGCCTCTAACTGG - Intronic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1097266370 12:57747674-57747696 AACTGGATCCTGCTTATTACAGG - Exonic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1119086241 14:71741837-71741859 AACCTAACCCAGCTTATCACCGG - Intergenic
1120893356 14:89508732-89508754 GATCGAAACCTGCATCTCACAGG - Intronic
1122722300 14:103728989-103729011 AGCCGGATCCTGCTTGGCACGGG + Intronic
1125508363 15:40280200-40280222 AAACGGCTCCTGCTTCTCGCTGG - Intronic
1127823612 15:62683394-62683416 TAGCGAATCCTGCCTCTCATTGG + Intronic
1129628454 15:77230877-77230899 AACCAAATTATGCTTCTTACTGG - Intronic
1138398564 16:56727435-56727457 AACAGAATCCTGTTTTTCAAAGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1151140691 17:71989467-71989489 AACCGAAGACTGCTTCACAAGGG + Intergenic
1158324974 18:56303764-56303786 CACCAAATCCTGCCTCTCATTGG - Intergenic
1158513621 18:58113094-58113116 AACCGAAACTTATTTCTCACAGG - Intronic
1158592801 18:58791700-58791722 AACAGAATTTTGTTTCTCACAGG - Intergenic
1159367286 18:67484492-67484514 AGGCGAATCCTGCCTCTCAAAGG - Intergenic
1160594576 18:79964797-79964819 CCCCGACTCCTGCTTCTCTCTGG + Intronic
1162265222 19:9567807-9567829 AATCGAATGCTGCTACTGACAGG + Intronic
1165686109 19:37821445-37821467 AACAGGATCCAGTTTCTCACAGG + Intergenic
1166989857 19:46685623-46685645 AAAGGAATCATGGTTCTCACAGG - Intronic
930337322 2:50065650-50065672 AACAAAATACTGCTTCTCACTGG - Intronic
932719647 2:74129744-74129766 AACAGACTCCTGCCTCTCTCTGG - Intergenic
933758105 2:85656400-85656422 AAGAGAAGCCTGCCTCTCACAGG - Intergenic
937314997 2:120926462-120926484 AACTTAACCCTGCTTCCCACTGG + Intronic
938559859 2:132462365-132462387 AACTGAAACCTACTTCTCAGGGG + Intronic
941423327 2:165311538-165311560 TACCTAATCCCACTTCTCACAGG + Intronic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
948139872 2:235664644-235664666 AAACCAAGCTTGCTTCTCACTGG + Intronic
1168971642 20:1935311-1935333 AACCTAGCCCTGCTTATCACCGG + Intronic
1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG + Intronic
1173957282 20:47043439-47043461 AAGCCAGTCCTGCTTCTCCCTGG + Intronic
1177738823 21:25127882-25127904 AACTGAATCATTCTTCTCTCTGG + Intergenic
1183644656 22:39117522-39117544 AACCGAAGGCTTCTTCTCAAAGG + Intergenic
949339489 3:3013472-3013494 AACGGAGTCCTGCTTATTACTGG + Intronic
952342412 3:32457275-32457297 AAGCAAACCCTACTTCTCACTGG + Intronic
952914410 3:38222395-38222417 AACCGAAATCTGCTTCTCAGGGG + Intronic
959293992 3:104512437-104512459 AACTGAATCTTGCTTATAACTGG - Intergenic
970806827 4:20046333-20046355 CACGGATTCCTGCTTCTCGCTGG - Intergenic
976230498 4:82837797-82837819 TACCCAATCCCACTTCTCACTGG + Intronic
978203521 4:106051180-106051202 AACAGAATCATGTCTCTCACTGG + Intronic
978446736 4:108787474-108787496 ACCTGGATCCTGCCTCTCACGGG - Intergenic
980184469 4:129444942-129444964 AACTGAATTCTAATTCTCACAGG + Intergenic
980816233 4:137950092-137950114 AAACCAATCCTAGTTCTCACTGG - Intergenic
984891537 4:184498571-184498593 AGCAGAATCCTGCTCCTCACAGG + Intergenic
985880092 5:2632881-2632903 GTAAGAATCCTGCTTCTCACAGG + Intergenic
986744193 5:10730176-10730198 AACAAAATCCCTCTTCTCACAGG - Intronic
987647384 5:20691402-20691424 AGCCGAAACCTGTTTCTCACAGG - Intergenic
993442104 5:87969927-87969949 AACCGAATTCTGCTGGGCACTGG - Intergenic
1008540939 6:52546002-52546024 AACAGAATCATCATTCTCACAGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1012868175 6:104642750-104642772 ACCTGGATCCTCCTTCTCACAGG + Intergenic
1026511910 7:71034412-71034434 AACTGAAGCCTGCTACTCAAGGG - Intergenic
1029690983 7:102181285-102181307 AACTGAATCCTGGTACTCATTGG - Intronic
1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG + Intergenic
1033807869 7:144975311-144975333 CACCCCATCCTGCTTCTCATGGG - Intergenic
1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG + Intergenic
1035613649 8:986733-986755 CACTGAAACCTGCTTCTCCCAGG + Intergenic
1039373912 8:37014214-37014236 AAGCGAATCCTCATCCTCACCGG - Intergenic
1049919711 9:351910-351932 AGACAAATCCTGATTCTCACAGG - Intronic
1052744433 9:32426339-32426361 AACTCAATCCTGCTGCTCAGGGG - Intronic
1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG + Intergenic
1057330635 9:94111517-94111539 AACAAAATCCTGTTTCTCAGTGG + Intergenic
1061012979 9:127966258-127966280 GTCTGAATCCTGCTGCTCACCGG + Intronic
1190733434 X:53239537-53239559 AACTGAATCCTGCTTCCTCCAGG + Intronic
1192669471 X:73124993-73125015 AACCTACTCCAGCTTCTCCCAGG + Intergenic
1195524002 X:105864959-105864981 AATAGAACCCTGCTTTTCACTGG - Intronic
1197260155 X:124308782-124308804 AACAGAAGCCTCTTTCTCACAGG - Intronic
1199905515 X:152225315-152225337 AACATAATTCTGCTGCTCACAGG + Intronic