ID: 1008589385

View in Genome Browser
Species Human (GRCh38)
Location 6:52977812-52977834
Sequence GGATTCGGTTGCGGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008589381_1008589385 -10 Left 1008589381 6:52977799-52977821 CCTGTGAGAAGCAGGATTCGGTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1008589385 6:52977812-52977834 GGATTCGGTTGCGGGGAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008589385 Original CRISPR GGATTCGGTTGCGGGGAAGC AGG Intergenic
903026423 1:20432675-20432697 AGGTTGGGTTGCTGGGAAGCAGG - Intergenic
903543851 1:24111464-24111486 GGATTCGGCCTCGCGGAAGCTGG - Intronic
906501204 1:46342738-46342760 GACTTCGGTTGGGGGGAAACTGG - Intronic
906533814 1:46540132-46540154 GGATGCGGGTGCTGGGAAGAGGG - Intergenic
908473966 1:64470695-64470717 GGCTCCGGGCGCGGGGAAGCGGG - Intergenic
908625684 1:66038611-66038633 GGATTTTGTGGTGGGGAAGCGGG + Intronic
908751567 1:67429628-67429650 GGACTGAGGTGCGGGGAAGCCGG - Intronic
913185025 1:116363058-116363080 GGATAGGGATGCAGGGAAGCTGG - Intergenic
915164889 1:153942886-153942908 GGTTGAGGTTGCGGGGCAGCCGG + Exonic
922496679 1:226062829-226062851 GGGCTCGGTTCCGGGGAAGCGGG - Intronic
1063753016 10:8973581-8973603 GGATTCGGTTGCATGGTGGCTGG + Intergenic
1065947026 10:30614254-30614276 GGAATCGGCTGGGGGGAAGCAGG + Intronic
1066210446 10:33232290-33232312 TGATTGGGTTGAGGGAAAGCAGG - Intronic
1068636260 10:59351664-59351686 GCATTCTTTTGCGGGGAAGATGG - Intronic
1082983484 11:59145176-59145198 GGGTTGGGGTGCGGAGAAGCAGG + Exonic
1084045088 11:66563756-66563778 GGAATGGGGTGCAGGGAAGCAGG + Exonic
1084049994 11:66593264-66593286 GGCTTCGGATTCGGGGAACCAGG + Exonic
1090412669 11:126519908-126519930 GGATTCCATGGCCGGGAAGCGGG - Intronic
1118062660 14:62157321-62157343 GGACTAGGTGGCAGGGAAGCGGG + Intergenic
1122604894 14:102941603-102941625 GGATTCGCTTGCAAGGAAGCAGG + Intronic
1123933336 15:25182351-25182373 GGATGCGTGTGCGGGGAAGGGGG + Intergenic
1135509234 16:23068251-23068273 GCATTTGGCTGCTGGGAAGCTGG + Exonic
1139992967 16:70954590-70954612 GGATTCTGTGGCTAGGAAGCTGG + Intronic
1143890824 17:10101135-10101157 GGATTCAGTTTCTGGGGAGCAGG + Intronic
1148337606 17:46851896-46851918 GGATTCGGAGCCGGGGAAGCTGG - Intronic
1151383154 17:73739358-73739380 GGATTCAATAGCGGGGAGGCTGG + Intergenic
1151691796 17:75691087-75691109 GGATTCTGCTGCTGGGAAGCTGG + Intronic
1153899499 18:9604272-9604294 GGATTCGAATGAGGGGAGGCTGG - Intronic
1161175782 19:2841595-2841617 GGATCCCGGTGCGGGGCAGCAGG + Intronic
1162718150 19:12646871-12646893 GTATTCGGGGCCGGGGAAGCAGG - Intronic
1162789986 19:13057823-13057845 GGCCTCGGTTGCGGGGAGGGAGG - Intronic
1163037332 19:14578043-14578065 GGATTCAGTTTCAGGGAAGGAGG + Intergenic
1166812848 19:45524499-45524521 GGAATAGGAGGCGGGGAAGCAGG + Intronic
931020073 2:58034357-58034379 GGAATCGGTAGCGGGCAAACTGG - Intronic
947860523 2:233354546-233354568 GGAGGCGGTTGCGGGGGACCCGG - Exonic
948103179 2:235391487-235391509 GGATCCTGTTGGGGTGAAGCAGG + Intergenic
1180762343 22:18220001-18220023 GGTTTCGGGGGCTGGGAAGCTGG + Intergenic
1180773325 22:18404607-18404629 GGTTTCGGGGGCTGGGAAGCTGG - Intergenic
1180804678 22:18654156-18654178 GGTTTCGGGGGCTGGGAAGCTGG - Intergenic
1180806070 22:18715254-18715276 GGTTTCGGGGGCTGGGAAGCTGG + Intergenic
1181192421 22:21151540-21151562 GGTTTCGGGGGCTGGGAAGCTGG - Intergenic
1181217018 22:21341035-21341057 GGTTTCGGGGGCTGGGAAGCTGG + Intergenic
1181521818 22:23452607-23452629 GGATTGGGCTTCAGGGAAGCAGG + Intergenic
1203235155 22_KI270731v1_random:145589-145611 GGTTTCGGGGGCTGGGAAGCTGG - Intergenic
951622361 3:24617021-24617043 GGATTGGGTAGAGGGAAAGCTGG + Intergenic
960699969 3:120429745-120429767 GGGTTCTGCTGCTGGGAAGCTGG + Intronic
961408178 3:126698240-126698262 GGGTTCTGTTGCAGGGAAGGGGG - Intergenic
969636135 4:8370424-8370446 GGAGGCGGTTGGGGGAAAGCGGG + Intronic
969642689 4:8408680-8408702 GGAGTCGTGTGCTGGGAAGCAGG - Intronic
999380496 5:151117880-151117902 GGATTTGGTTGCGGGGAGGGAGG + Intronic
1004580014 6:16940913-16940935 GGATTCTGTTACAGGGAAGAAGG + Intergenic
1006215808 6:32441641-32441663 GGGTTTGGATGCTGGGAAGCAGG + Intronic
1006378514 6:33684742-33684764 GGACTCGGTTGAGGGAGAGCTGG - Intronic
1008589385 6:52977812-52977834 GGATTCGGTTGCGGGGAAGCAGG + Intergenic
1019565702 7:1678070-1678092 GGATTCGGGTGCGGGAACACTGG - Intergenic
1019589522 7:1823879-1823901 GGATTGGGCTTCAGGGAAGCAGG - Intronic
1024615505 7:51108386-51108408 GGATTCGGTTGGGGTGAGCCTGG + Intronic
1025804113 7:64813170-64813192 GGTTTCTGTTGGGGGAAAGCTGG + Intronic
1031436216 7:121735277-121735299 GGATTCAGATGCAGGGAATCTGG - Intergenic
1033129747 7:138735584-138735606 GGAGCCGGCTGCTGGGAAGCGGG + Intronic
1033503386 7:141976371-141976393 GGACTCGGTTGCTGGGGAGCTGG - Intronic
1038498426 8:28023783-28023805 GGATTGGGGTGGGGGGAAGAGGG - Intronic
1041180436 8:55242139-55242161 TGATTAAGTTGAGGGGAAGCAGG - Intronic
1045517952 8:102877413-102877435 GGGTTCGGTGCCTGGGAAGCAGG - Intronic
1052682418 9:31710499-31710521 GTATTAGGTTGCGGCGAAACTGG + Intergenic
1055029358 9:71757755-71757777 GGTTTGGTTTGAGGGGAAGCAGG + Intronic
1060379054 9:123148192-123148214 GGATTAGGTGGTGGGGAACCTGG + Intronic
1186108020 X:6227115-6227137 GAATTGGGAGGCGGGGAAGCGGG + Intronic
1195636226 X:107118640-107118662 GGATGCGGTTTCGTGGGAGCGGG - Intronic
1198510811 X:137349714-137349736 GGAATGGGTTTCGGAGAAGCTGG - Intergenic
1199308764 X:146298039-146298061 GGACTTGGTTGCGGGGGACCAGG - Intergenic
1200122198 X:153796419-153796441 GGCCTCGGCTGCGGGGAAGAGGG - Exonic