ID: 1008589386

View in Genome Browser
Species Human (GRCh38)
Location 6:52977813-52977835
Sequence GATTCGGTTGCGGGGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008589381_1008589386 -9 Left 1008589381 6:52977799-52977821 CCTGTGAGAAGCAGGATTCGGTT 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1008589386 6:52977813-52977835 GATTCGGTTGCGGGGAAGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008589386 Original CRISPR GATTCGGTTGCGGGGAAGCA GGG Intergenic
903026422 1:20432674-20432696 GGTTGGGTTGCTGGGAAGCAGGG - Intergenic
905359641 1:37410541-37410563 GACTGGGCTGAGGGGAAGCAGGG + Intergenic
905390111 1:37630745-37630767 GATCCCGTGACGGGGAAGCAGGG - Intronic
907624709 1:56018016-56018038 GATTAGGTTGGGGGAAAGAATGG - Intergenic
909957880 1:81801571-81801593 GACTCGGGCTCGGGGAAGCAAGG - Intronic
1071439439 10:85677367-85677389 GATTCAGTTGAGGGGGAGTAGGG + Intronic
1075507500 10:123037311-123037333 GATATAGTTGAGGGGAAGCAAGG + Intronic
1076458438 10:130621477-130621499 GATCCAGTGGCGGGTAAGCAAGG - Intergenic
1078003111 11:7513617-7513639 GCTCCGGTTGCGGGGAGGCCCGG - Intronic
1079721459 11:23819389-23819411 TATTCGGTTGGGGGGAAGGAAGG - Intergenic
1084045089 11:66563757-66563779 GAATGGGGTGCAGGGAAGCAGGG + Exonic
1084049995 11:66593265-66593287 GCTTCGGATTCGGGGAACCAGGG + Exonic
1084191372 11:67500456-67500478 GCTGCGGTGGCAGGGAAGCAGGG - Intronic
1090462896 11:126907763-126907785 GATGAGGTTGCAGGGCAGCAGGG - Intronic
1091395351 12:151029-151051 GATTCAGTAGAGGGGAGGCACGG + Intronic
1091395375 12:151186-151208 GATTCAGTAGAGGGGAGGCACGG + Intronic
1095310569 12:40692755-40692777 GGCTGGGGTGCGGGGAAGCAGGG + Intronic
1102678742 12:114675875-114675897 GACTGGGTGGGGGGGAAGCAAGG - Intronic
1106842483 13:33699249-33699271 GTTTGGGTGGCTGGGAAGCAGGG - Intergenic
1108588698 13:51893407-51893429 GATTAGGGTGCAGGGAAGGAGGG - Intergenic
1112726597 13:102311463-102311485 GATTCAGCTGTGGGGAAGGATGG - Intronic
1114385698 14:22252062-22252084 GTTTGGGTTGCAGGGAAGGAAGG + Intergenic
1114828132 14:26106138-26106160 GATGAGGTTGAGGGGAACCATGG + Intergenic
1123804592 15:23858195-23858217 CATTTGGTTCCAGGGAAGCAAGG + Intergenic
1134434059 16:14238501-14238523 GATTGGGATGCTGGGAAGCGAGG + Intronic
1135536984 16:23302268-23302290 GGTTCAGGGGCGGGGAAGCACGG - Exonic
1144179551 17:12739260-12739282 CAGTCAGATGCGGGGAAGCAGGG + Exonic
1151691797 17:75691088-75691110 GATTCTGCTGCTGGGAAGCTGGG + Intronic
1157109679 18:44808873-44808895 GATTAGGATGAGGGAAAGCAAGG - Intronic
1161249851 19:3274726-3274748 GATTTGGTTGAGTGGAGGCATGG + Intronic
1161579382 19:5072316-5072338 GATTCGGTGGTGGGGACGGAGGG + Intronic
1162303883 19:9859796-9859818 GATTGGGGTGGGGGGAAGGAAGG - Intronic
1162789985 19:13057822-13057844 GCCTCGGTTGCGGGGAGGGAGGG - Intronic
1167757304 19:51421034-51421056 GATTAGGTCACAGGGAAGCAGGG - Intergenic
928451387 2:31381495-31381517 GATTTGGATCCAGGGAAGCATGG - Intronic
929022677 2:37569014-37569036 GATTGGGGTGGGGGGAAGAAAGG + Intergenic
1169780220 20:9301589-9301611 CATTCGGTTGGGGTGAACCAAGG - Intronic
1172775768 20:37405887-37405909 GCTTCGGTGGTGGGGAAGGAGGG - Exonic
1175495614 20:59412058-59412080 GATTCGGTGTCGGGGGAGCACGG + Intergenic
1176126523 20:63477827-63477849 TATCCGCTTGCGGGGGAGCAGGG + Intergenic
953494221 3:43372471-43372493 GGTTGGATTGCGGGGCAGCAGGG - Intronic
954197556 3:49005597-49005619 GACTGGGTTTCGGGGAAGGAGGG + Intronic
964214484 3:154263946-154263968 GATTCGATTGAGTGGAAGAAAGG + Intergenic
969642688 4:8408679-8408701 GAGTCGTGTGCTGGGAAGCAGGG - Intronic
984280548 4:177665076-177665098 GATTCGCTTCCAGTGAAGCATGG - Intergenic
987370412 5:17187762-17187784 GACTCTGTAGCTGGGAAGCAAGG + Intronic
1004580015 6:16940914-16940936 GATTCTGTTACAGGGAAGAAGGG + Intergenic
1006215809 6:32441642-32441664 GGTTTGGATGCTGGGAAGCAGGG + Intronic
1008589386 6:52977813-52977835 GATTCGGTTGCGGGGAAGCAGGG + Intergenic
1011660437 6:89589835-89589857 GATTTGGTTCCCTGGAAGCAAGG + Intronic
1013585342 6:111573496-111573518 GAGTGGATTGCGGGGAAGAAGGG - Intronic
1018650576 6:165988505-165988527 GGCTGGGGTGCGGGGAAGCAGGG + Intergenic
1033915663 7:146322107-146322129 GAGTGGGTTGAGGGGAAGGAAGG + Intronic
1044438028 8:92188936-92188958 GATTCGGTCACGCCGAAGCAGGG - Intergenic
1044692459 8:94894683-94894705 GCGGCGGTGGCGGGGAAGCAGGG + Intronic
1055029359 9:71757756-71757778 GTTTGGTTTGAGGGGAAGCAGGG + Intronic
1187737777 X:22322200-22322222 GATTAGGTTGCGAGGACCCAGGG - Intergenic
1192691243 X:73367010-73367032 GATGCTGTTGGGGGGAGGCATGG - Intergenic
1199308763 X:146298038-146298060 GACTTGGTTGCGGGGGACCAGGG - Intergenic